> >>PTPRK-protein tyrosine phosphatase, receptor type, K Gene
PTPRK-protein tyrosine phosphatase, receptor type, K Gene View larger

PTPRK-protein tyrosine phosphatase, receptor type, K Gene

PTXBC063596

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of PTPRK-protein tyrosine phosphatase, receptor type, K Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PTPRK-protein tyrosine phosphatase, receptor type, K Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC063596
Product type: DNA & cDNA
Ncbi symbol: PTPRK
Origin species: Human
Product name: PTPRK-protein tyrosine phosphatase, receptor type, K Gene
Size: 2ug
Accessions: BC063596
Gene id: 5796
Gene description: protein tyrosine phosphatase, receptor type, K
Synonyms: R-PTP-kappa; receptor-type tyrosine-protein phosphatase kappa; dJ480J14.2.1 (protein tyrosine phosphatase, receptor type, K (R-PTP-KAPPA, protein tyrosine phosphatase kappa , protein tyrosine phosphatase kappa; protein-tyrosine phosphatase kappa; protein-tyrosine phosphatase, receptor type, kappa; protein tyrosine phosphatase, receptor type K
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatacgactgcggcggcggcgctgcctgcttttgtggcgctcttgctcctctctccttggcctctcctgggatcggcccaaggccagttctccgcagtgtctgtgcttgtggtcggtaacttttgctgctgttgttctgctgctgtctgccattccattcgccatctatcacgcacacagaaccctggccaggatcatgaagggcgattgaaaaggtggctgtacttttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein tyrosine phosphatase, receptor type, F
- receptor-interacting serine-threonine kinase 3
- NIMA (never in mitosis gene a)-related kinase 2
- HERV-FRD provirus ancestral Env polyprotein

Reviews

Buy PTPRK-protein tyrosine phosphatase, receptor type, K Gene now

Add to cart