Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CACNG2-calcium channel, voltage-dependent, gamma subunit 2 Gene
PTXBC069612
New product
Data sheet of CACNG2-calcium channel, voltage-dependent, gamma subunit 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CACNG2-calcium channel, voltage-dependent, gamma subunit 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069612 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CACNG2 |
| Origin species: | Human |
| Product name: | CACNG2-calcium channel, voltage-dependent, gamma subunit 2 Gene |
| Size: | 2ug |
| Accessions: | BC069612 |
| Gene id: | 10369 |
| Gene description: | calcium channel, voltage-dependent, gamma subunit 2 |
| Synonyms: | MRD10; voltage-dependent calcium channel gamma-2 subunit; TARP gamma-2; calcium channel, voltage-dependent, gamma subunit 2; neuronal voltage-gated calcium channel gamma-2 subunit; transmembrane AMPAR regulatory protein gamma-2; calcium voltage-gated channel auxiliary subunit gamma 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggctgtttgatcgaggtgttcaaatgcttttaaccaccgttggtgctttcgctgccttcagcctgatgaccatagctgtgggaaccgactattggctctactccagaggggtttgcaagaccaaaagtgtcagtgagaatgaaaccagcaaaaagaacgaggaagttatgacccattccggattatggagaacctgctgcctagaagggaatttcaaaggtctgtgcaagcaaattgatcacttcccagaggatgcagattacgaagctgacacagcagaatatttcctccgggccgtgagggcctccagcattttcccaatcctgagtgtgattctgcttttcatgggtggcctctgcatcgcagccagcgagttctacaaaactcgacacaacatcatcctgagtgccggcatcttcttcgtgtctgcaggtctgagtaacatcattggcatcatagtgtacatatctgccaatgccggagacccctccaagagcgactccaaaaagaatagttactcatacggctggtccttctacttcggggccctgtccttcatcatcgccgagatggtcggggtgctggcggtgcacatgtttatcgaccggcacaaacagctgcgggccacggcccgcgccacggactacctccaggcctctgccatcacccgcatccccagctaccgctaccgctaccagcgccgcagccgctccagctcgcgctccacggagccctcacactccagggacgcctcccccgtgggcatcaagggcttcaacaccctgccgtccacggagatctccatgtacacgctcagcagggaccccctgaaggccgccaccacgcccaccgccacctacaactccgacagggataacagcttcctccaggttcacaactgtatccagaaggagaacaaggactctctccactccaacacagccaaccgccggaccacccccgtataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - membrane-spanning 4-domains, subfamily A, member 6E - purinergic receptor P2X, ligand-gated ion channel, 1 - poly(A) binding protein, cytoplasmic, pseudogene 2 - karyopherin alpha 2 (RAG cohort 1, importin alpha 1) |