P2RX1-purinergic receptor P2X, ligand-gated ion channel, 1 Gene View larger

P2RX1-purinergic receptor P2X, ligand-gated ion channel, 1 Gene

PTXBC027949

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of P2RX1-purinergic receptor P2X, ligand-gated ion channel, 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about P2RX1-purinergic receptor P2X, ligand-gated ion channel, 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027949
Product type: DNA & cDNA
Ncbi symbol: P2RX1
Origin species: Human
Product name: P2RX1-purinergic receptor P2X, ligand-gated ion channel, 1 Gene
Size: 2ug
Accessions: BC027949
Gene id: 5023
Gene description: purinergic receptor P2X, ligand-gated ion channel, 1
Synonyms: P2X purinoceptor 1; ATP receptor; P2X receptor, subunit 1; P2X1 receptor; purinergic receptor P2X, ligand gated ion channel, 1; purinergic receptor P2X1; purinergic receptor P2X 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcacggcggttccaggaggagctggccgccttcctcttcgagtatgacaccccccgcatggtgctggtgcgtaataagaaggtgggcgttatcttccgactgatccagctggtggtcctggtctacgtcatcgggtgggtgtttctctatgagaagggctaccagacctcgagcggcctcatcagcagtgtctctgtgaaactcaagggcctggccgtgacccagctccctggcctcggcccccaggtctgggatgtggctgactacgtcttcccagcccagggggacaactccttcgtggtcatgaccaatttcatcgtgaccccgaagcagactcaaggctactgcgcagagcacccagaagggggcatatgcaaggaagacagtggctgtacccctgggaaggccaagaggaaggcccaaggcatccgcacgggcaagtgtgtggccttcaacgacactgtgaagacgtgtgagatctttggctggtgccccgtggaggtggatgacgacatcccgcggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - poly(A) binding protein, cytoplasmic, pseudogene 2
- karyopherin alpha 2 (RAG cohort 1, importin alpha 1)
- LATS, large tumor suppressor, homolog 1 (Drosophila)
- eukaryotic translation initiation factor 4 gamma, 3

Reviews

Buy P2RX1-purinergic receptor P2X, ligand-gated ion channel, 1 Gene now

Add to cart