Cart 6 Product Products 1 062,11 € (empty)
-
1 x CLEC2B-C-t...113,40 € -
1 x FAM81B-fam...121,50 € -
-
-
1 x PTDSS1-pho...121,50 € -
1 x Goat...180,71 €
No products
To be determined Shipping
1 062,11 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 062,11 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 062,11 €
View larger 
P2RX1-purinergic receptor P2X, ligand-gated ion channel, 1 Gene
PTXBC027949
New product
Data sheet of P2RX1-purinergic receptor P2X, ligand-gated ion channel, 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about P2RX1-purinergic receptor P2X, ligand-gated ion channel, 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC027949 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | P2RX1 |
| Origin species: | Human |
| Product name: | P2RX1-purinergic receptor P2X, ligand-gated ion channel, 1 Gene |
| Size: | 2ug |
| Accessions: | BC027949 |
| Gene id: | 5023 |
| Gene description: | purinergic receptor P2X, ligand-gated ion channel, 1 |
| Synonyms: | P2X purinoceptor 1; ATP receptor; P2X receptor, subunit 1; P2X1 receptor; purinergic receptor P2X, ligand gated ion channel, 1; purinergic receptor P2X1; purinergic receptor P2X 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcacggcggttccaggaggagctggccgccttcctcttcgagtatgacaccccccgcatggtgctggtgcgtaataagaaggtgggcgttatcttccgactgatccagctggtggtcctggtctacgtcatcgggtgggtgtttctctatgagaagggctaccagacctcgagcggcctcatcagcagtgtctctgtgaaactcaagggcctggccgtgacccagctccctggcctcggcccccaggtctgggatgtggctgactacgtcttcccagcccagggggacaactccttcgtggtcatgaccaatttcatcgtgaccccgaagcagactcaaggctactgcgcagagcacccagaagggggcatatgcaaggaagacagtggctgtacccctgggaaggccaagaggaaggcccaaggcatccgcacgggcaagtgtgtggccttcaacgacactgtgaagacgtgtgagatctttggctggtgccccgtggaggtggatgacgacatcccgcggtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - poly(A) binding protein, cytoplasmic, pseudogene 2 - karyopherin alpha 2 (RAG cohort 1, importin alpha 1) - LATS, large tumor suppressor, homolog 1 (Drosophila) - eukaryotic translation initiation factor 4 gamma, 3 |