Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 430,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 430,00 €
View larger 
PABPCP2-poly(A) binding protein, cytoplasmic, pseudogene 2 Gene
PTXBC068242
New product
Data sheet of PABPCP2-poly(A) binding protein, cytoplasmic, pseudogene 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PABPCP2-poly(A) binding protein, cytoplasmic, pseudogene 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC068242 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PABPCP2 |
| Origin species: | Human |
| Product name: | PABPCP2-poly(A) binding protein, cytoplasmic, pseudogene 2 Gene |
| Size: | 2ug |
| Accessions: | BC068242 |
| Gene id: | 728773 |
| Gene description: | poly(A) binding protein, cytoplasmic, pseudogene 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatgggatgctcctgaatggtctcaatgtatttgttggacggtttaggtctcctaaagaacaagaagcagaacttggagctagggcaaaagagtccaaagttggacctgcctcaagtgtaaaagtaataactgatgaaggtggaaaatccaaaggatttggatttgtaagctttgaaaggcatgaagatccacagacagctatggatgtgaatggaaaggagttcagtggaaatcaaacttacatttgtctagctccgaaaaaagtggaagagcagacagaacttaagtgcaaatttgaacagatgaagcaagatagaatcaccagataccagggtgctaacgtttgtgtgaaaaatcttgatgagagtattgatgatgaacgtctccagaaagaattttctccatttggtataatcaatagtgcaaatgttatgatggagggtggttgcagcaaaaggtttggctttgtatgtttctcctccccagaagaagtagctaaagcagttacagcaatgaacggtaaaattgtggccagcaagccattgcatgtagctttagctcagtgcaaagaacagcgcctggctcacttcactaaccaatacatgcagaagatggcaagtgtacgagctgtgccccaccctgtaatcaacccctaccagccagcaccttctacatgttacttcgtagcagctatcccacagacccagaaccgtgctgcatactatcctcctggccaaattgctcaactaagaccaagtcctccctgggctgttcagagtgtcagaccttatccattccaaatatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - karyopherin alpha 2 (RAG cohort 1, importin alpha 1) - LATS, large tumor suppressor, homolog 1 (Drosophila) - eukaryotic translation initiation factor 4 gamma, 3 - CDK5 regulatory subunit associated protein 1-like 1 |