Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CDKAL1-CDK5 regulatory subunit associated protein 1-like 1 Gene
PTXBC064145
New product
Data sheet of CDKAL1-CDK5 regulatory subunit associated protein 1-like 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CDKAL1-CDK5 regulatory subunit associated protein 1-like 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC064145 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CDKAL1 |
| Origin species: | Human |
| Product name: | CDKAL1-CDK5 regulatory subunit associated protein 1-like 1 Gene |
| Size: | 2ug |
| Accessions: | BC064145 |
| Gene id: | 54901 |
| Gene description: | CDK5 regulatory subunit associated protein 1-like 1 |
| Synonyms: | threonylcarbamoyladenosine tRNA methylthiotransferase; tRNA-t(6)A37 methylthiotransferase; CDK5 regulatory subunit associated protein 1 like 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccttctgcatcctgtgatacactactggatgacatcgaagatatcgtgtctcaggaagattcaaaaccacaagataggcattttgtaagaaaggatgttgtcccgaaggtacgaaggcgaaatacccaaaaatatttgcaagaggaagaaaacagtccaccaagtgacagcactattccaggcatacagaaaatttggatacgaacatggggttgttctcataataattcagatggagaatatatggctggacagctagctgcttatggctataaaattacaggtgaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dynein, cytoplasmic 2, light intermediate chain 1 - dystroglycan 1 (dystrophin-associated glycoprotein 1) - similar to chemokine (C-C motif) receptor-like 2 - fasciculation and elongation protein zeta 1 (zygin I) |