Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
DYNC2LI1-dynein, cytoplasmic 2, light intermediate chain 1 Gene
PTXBC040558
New product
Data sheet of DYNC2LI1-dynein, cytoplasmic 2, light intermediate chain 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DYNC2LI1-dynein, cytoplasmic 2, light intermediate chain 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC040558 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DYNC2LI1 |
| Origin species: | Human |
| Product name: | DYNC2LI1-dynein, cytoplasmic 2, light intermediate chain 1 Gene |
| Size: | 2ug |
| Accessions: | BC040558 |
| Gene id: | 51626 |
| Gene description: | dynein, cytoplasmic 2, light intermediate chain 1 |
| Synonyms: | CGI-60; D2LIC; LIC3; SRTD15; cytoplasmic dynein 2 light intermediate chain 1; dynein cytoplasmic 2 light intermediate chain 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccagtgaaactctctgggaaattgcaaaagctgaagtggaaaaaaggggaattaatggaagtgaaggtgatggagctgaaattgcagaaaaatttgttttcttcattggcagtaaaaatgggggaaagactactattattctaaggtgtcttgacagagatgaaccaccaaaaccaaccttagctttggaatatacatatggaagaagagcaaaagggcacaacacaccaaaagatatcgctcacttttgggaactcggtggaggaacctctttattggacttaatcagcatacccatcacaggtgacaccttacgctcctggcaactatcatccctactgcctgtctctatgaatttgaccactccagtacctcatataaatgaaatcattcattatttgtccttttgttatttatttcatttagcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dystroglycan 1 (dystrophin-associated glycoprotein 1) - similar to chemokine (C-C motif) receptor-like 2 - fasciculation and elongation protein zeta 1 (zygin I) - fusion (involved in t(12;16) in malignant liposarcoma) |