Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MS4A6E-membrane-spanning 4-domains, subfamily A, member 6E Gene
PTXBC069322
New product
Data sheet of MS4A6E-membrane-spanning 4-domains, subfamily A, member 6E Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MS4A6E-membrane-spanning 4-domains, subfamily A, member 6E Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069322 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MS4A6E |
| Origin species: | Human |
| Product name: | MS4A6E-membrane-spanning 4-domains, subfamily A, member 6E Gene |
| Size: | 2ug |
| Accessions: | BC069322 |
| Gene id: | 245802 |
| Gene description: | membrane-spanning 4-domains, subfamily A, member 6E |
| Synonyms: | membrane-spanning 4-domains subfamily A member 6E; membrane-spanning 4-domains, subfamily A, member 6E; membrane spanning 4-domains A6E |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacatcacaacctatttccaatgagaccatcataatgctcccatcaaatgtcatcaacttctcccaagcagagaaacccgaacccaccaaccaggggcaggatagcctgaagaaacgtctacaggcaaaagtcaaagttattggggtgcatagcagcctggctggaagcattctgagtgctctgtctgccctggtgggtttcattctcctgtctgtcaacccggctgcattaaatcctgcctcattgcagtgtaagttggacgaaaaggatataccaaccagacttcttctttcttatgattatcattcaccttacaccatggactgccatagagccaaagccagtctggctggaactctgtctctgatgctggtttctactgtgttggagttctgcctagctgtgctcactgctgtgctgcagtggaaacagactgtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - purinergic receptor P2X, ligand-gated ion channel, 1 - poly(A) binding protein, cytoplasmic, pseudogene 2 - karyopherin alpha 2 (RAG cohort 1, importin alpha 1) - LATS, large tumor suppressor, homolog 1 (Drosophila) |