LOC494141-similar to mitochondrial carrier triple repeat 1 Gene View larger

LOC494141-similar to mitochondrial carrier triple repeat 1 Gene

PTXBC056262

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC494141-similar to mitochondrial carrier triple repeat 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LOC494141-similar to mitochondrial carrier triple repeat 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC056262
Product type: DNA & cDNA
Ncbi symbol: LOC494141
Origin species: Human
Product name: LOC494141-similar to mitochondrial carrier triple repeat 1 Gene
Size: 2ug
Accessions: BC056262
Gene id: 494141
Gene description: similar to mitochondrial carrier triple repeat 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaaaaagaagaacttaagcaacatgatggattcagaagctcatggaaagagaccaccaatactaacatcttcgaaacaagatatgtcacctcatattacagatttagtgaaatgaagcattacttgtgtggctgctgtgcagccttcaacaacgtcgcaatcacatttctcattcagaaggtcctctttccacaacagctgtatggcatcaaaacgggggatgcaatacttcagttgagaacggatggatttcgaaacttgtatcggggaatctttccccgattgatgcagaagacaactacacttgcacttacgtttggtctgtatgaggatttatcctaccttctccacaagcatgtcagtgctccagagtttgcaacctgtggcgtggcagcagtgcttgcagggacaacggaagcaattttcacttcagacattgcttcaagaccacaagcaccatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - regulation of nuclear pre-mRNA domain containing 1A
- calcium channel, voltage-dependent, gamma subunit 2
- membrane-spanning 4-domains, subfamily A, member 6E
- purinergic receptor P2X, ligand-gated ion channel, 1

Reviews

Buy LOC494141-similar to mitochondrial carrier triple repeat 1 Gene now

Add to cart