Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PAGE2-P antigen family, member 2 (prostate associated) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PAGE2-P antigen family, member 2 (prostate associated) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC054022 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PAGE2 |
| Origin species: | Human |
| Product name: | PAGE2-P antigen family, member 2 (prostate associated) Gene |
| Size: | 2ug |
| Accessions: | BC054022 |
| Gene id: | 203569 |
| Gene description: | P antigen family, member 2 (prostate associated) |
| Synonyms: | CT16.4; GAGEC2; GAGEE2; PAGE-2; P antigen family member 2; G antigen family C 2; G antigen, family E, 2; P antigen family, member 2 (prostate associated); g antigen family E member 2; prostate-associated gene 2 protein; PAGE family member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtgagcttctaagagcaagatcccaatcctcagaaagaggaaatgaccaagagtcttcccagccggttggatctgtgattgtccaggagcccactgaggaaaaacgtcaagaagaggaaccaccaactgataatcagggtattgcacctagtggggagattgaaaatcaagcagtgcctgcttttcaagggcctgacatggaagcttttcaacaggaactggctctgcttaagatagaggatgagcctggagatggtcctgatgtcagggaggggattatgcccacttttgatctcactaaagtgctggaagcaggtgatgcgcaaccatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CD244 molecule, natural killer cell receptor 2B4 - phosphodiesterase 6H, cGMP-specific, cone, gamma - cystatin 8 (cystatin-related epididymal specific) - 5,10-methylenetetrahydrofolate reductase (NADPH) |