Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PDE6H-phosphodiesterase 6H, cGMP-specific, cone, gamma Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PDE6H-phosphodiesterase 6H, cGMP-specific, cone, gamma Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069800 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PDE6H |
| Origin species: | Human |
| Product name: | PDE6H-phosphodiesterase 6H, cGMP-specific, cone, gamma Gene |
| Size: | 2ug |
| Accessions: | BC069800 |
| Gene id: | 5149 |
| Gene description: | phosphodiesterase 6H, cGMP-specific, cone, gamma |
| Synonyms: | ACHM6; RCD3; retinal cone rhodopsin-sensitive cGMP 3',5'-cyclic phosphodiesterase subunit gamma; GMP-PDE gamma; phosphodiesterase 6H, cGMP-specific, cone, gamma; phosphodiesterase 6H |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtgacaacactactctgcctgctccagcttcaaaccagggtcctaccaccccacgcaaaggccctcccaagttcaagcagaggcagactcgccaattcaagagtaaacctccaaagaaaggtgtgaaaggatttggagatgacattccaggaatggaggggctaggaacagatatcacagtgatttgtccatgggaggcattcagccacctggaattgcatgagctcgctcagtttgggattatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cystatin 8 (cystatin-related epididymal specific) - 5,10-methylenetetrahydrofolate reductase (NADPH) - cystatin 8 (cystatin-related epididymal specific) - angiogenic factor with G patch and FHA domains 1 |