Login to display prices
Login to display prices
PDE6H-phosphodiesterase 6H, cGMP-specific, cone, gamma Gene View larger

PDE6H-phosphodiesterase 6H, cGMP-specific, cone, gamma Gene

PTXBC069800

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDE6H-phosphodiesterase 6H, cGMP-specific, cone, gamma Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PDE6H-phosphodiesterase 6H, cGMP-specific, cone, gamma Gene

Proteogenix catalog: PTXBC069800
Ncbi symbol: PDE6H
Product name: PDE6H-phosphodiesterase 6H, cGMP-specific, cone, gamma Gene
Size: 2ug
Accessions: BC069800
Gene id: 5149
Gene description: phosphodiesterase 6H, cGMP-specific, cone, gamma
Synonyms: ACHM6; RCD3; retinal cone rhodopsin-sensitive cGMP 3',5'-cyclic phosphodiesterase subunit gamma; GMP-PDE gamma; phosphodiesterase 6H, cGMP-specific, cone, gamma; phosphodiesterase 6H
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgacaacactactctgcctgctccagcttcaaaccagggtcctaccaccccacgcaaaggccctcccaagttcaagcagaggcagactcgccaattcaagagtaaacctccaaagaaaggtgtgaaaggatttggagatgacattccaggaatggaggggctaggaacagatatcacagtgatttgtccatgggaggcattcagccacctggaattgcatgagctcgctcagtttgggattatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: