Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CST8-cystatin 8 (cystatin-related epididymal specific) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CST8-cystatin 8 (cystatin-related epididymal specific) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069536 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CST8 |
| Origin species: | Human |
| Product name: | CST8-cystatin 8 (cystatin-related epididymal specific) Gene |
| Size: | 2ug |
| Accessions: | BC069536 |
| Gene id: | 10047 |
| Gene description: | cystatin 8 (cystatin-related epididymal specific) |
| Synonyms: | CRES; CTES5; cystatin-8; cystatin 8 (cystatin-related epididymal specific); cystatin-related epididymal spermatogenic protein; cystatin 8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcaagaatacaacaaagagagcgaggacaagtatgtcttcctggtggtcaagacactgcaagcccagcttcaggtcacaaatcttctggaataccttattgatgtagaaattgcccgcagcgattgcagaaagcccttaagcactaatgaaatctgcgccattcaagaaaactccaagctgaaaaggaaattaagctgcagctttttggtaggagcacttccctggaatggtgaattcactgtgatggagaaaaagtgtgaagatgcttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - 5,10-methylenetetrahydrofolate reductase (NADPH) - cystatin 8 (cystatin-related epididymal specific) - angiogenic factor with G patch and FHA domains 1 - Rap guanine nucleotide exchange factor (GEF) 3 |