Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CD244-CD244 molecule, natural killer cell receptor 2B4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CD244-CD244 molecule, natural killer cell receptor 2B4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC028073 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CD244 |
| Origin species: | Human |
| Product name: | CD244-CD244 molecule, natural killer cell receptor 2B4 Gene |
| Size: | 2ug |
| Accessions: | BC028073 |
| Gene id: | 51744 |
| Gene description: | CD244 molecule, natural killer cell receptor 2B4 |
| Synonyms: | CD244 molecule; CD244 molecule, natural killer cell receptor 2B4; 2B4; NAIL; NKR2B4; Nmrk; SLAMF4; natural killer cell receptor 2B4; NK cell activation inducing ligand NAIL; NK cell activation-inducing ligand; NK cell type I receptor protein 2B4; SLAM family member 4; h2B4; signaling lymphocytic activation molecule 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctggggcaagtggtcaccctcatactcctcctgctcctcaaggtgtatcagggcaaaggatgccagggatcagctgaccatgtggttagcatctcgggagtgcctcttcagttacaaccaaacagcatacagacgaaggttgacagcattgcatggaagaagttgctgccctcacaaaatggatttcatcacatattgaagtgggagaatggctctttgccttccaatacttccaatgatagattcagttttatagtcaagaacttgagtcttctcatcaaggcagctcagcagcaggacagtggcctctactgcctggaggtcaccagtatatctggaaaagttcagacagccacgttccaggtttttgtatttgataaagttgagaaaccccgcctacaggggcaggggaagatcctggacagagggagatgccaagtggctctgtcttgcttggtctccagggatggcaatgtgtcctatgcttggtacagagggagcaagctgatccagacagcagggaacctcacctacctggacgaggaggttgacattaatggcactcacacatatacctgcaatgtcagcaatcctgttagctgggaaagccacaccctgaatctcactcaggactgtcagaatgcccatcaggaattcagattttggccgtttttggtgatcatcgtgattctaagcgcactgttccttggcacccttgcctgcttctgtgtgtggaggagaaagaggaaggagaagcagtcagagaccagtcccaaggaatttttgacaatttacgaagatgtcaaggatctgaaaaccaggagaaatcacgagcaggagcagacttttcctggaggggggagcaccatctactctatgatccagtcccagtcttctgctcccacgtcacaagaacctgcatatacattatattcattaattcagccttccaggaagtctggatccaggaagaggaaccacagcccttccttcaatagcactatctatgaagtgattggaaagagtcaacctaaagcccagaaccctgctcgattgagccgcaaagagctggagaactttgatgtttattcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphodiesterase 6H, cGMP-specific, cone, gamma - cystatin 8 (cystatin-related epididymal specific) - 5,10-methylenetetrahydrofolate reductase (NADPH) - cystatin 8 (cystatin-related epididymal specific) |