Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PIGK-phosphatidylinositol glycan anchor biosynthesis, class K Gene
PTXBC020737
New product
Data sheet of PIGK-phosphatidylinositol glycan anchor biosynthesis, class K Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PIGK-phosphatidylinositol glycan anchor biosynthesis, class K Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020737 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PIGK |
| Origin species: | Human |
| Product name: | PIGK-phosphatidylinositol glycan anchor biosynthesis, class K Gene |
| Size: | 2ug |
| Accessions: | BC020737 |
| Gene id: | 10026 |
| Gene description: | phosphatidylinositol glycan anchor biosynthesis, class K |
| Synonyms: | GPI8; GPI-anchor transamidase; GPI transamidase subunit; GPI8 homolog; PIG-K; phosphatidylinositol glycan, class K; phosphatidylinositol-glycan biosynthesis class K protein; phosphatidylinositol glycan anchor biosynthesis class K |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgtcaccgacagcctcagccgggctgcgactgtcttggcaactgtgttgctcttgtccttcggcagcgtggccgctagtcatatcgaggatcaagcagaacaattctttagaagtggccatacaaacaactgggctgttctggtgtgtacatcccgattctggtttaattatcgacatgttgcaaataccctttctgtttatagaagtgtcaagaggctaggtattcctgacagtcacattgtcctaatgcttgcagatgatatggcctgtaatcctagaaatcccaaaccagctacagtgtttagtcacaagaatatggaactaaatgtgtatggagatgatgtggaagtggattatagaagttatgaggtaactgtggagaattttttacgggtattaactgggaggatcccacctagtactcctcggtcaaaacgtcttctttctgatgacagaagcaatattctaatttatatgacagggcatggtggaaatggtttcttaaaatttcaagattctgaagaaattaccaacatagaactcgcggatgcttttgaacaaatgtggcagaaaagacgctacaatgagctactgtttattattgatacttgccaaggagcatccatgtatgaacgattttattctcctaacataatggctctagctagtagtcaagtgggagaagattcactctcgcatcaacctgatcctgcaattggagtccatcttatggatagatacacattttatgtcttggaatttttggaagaaattaacccagctagccaaactaatatgaatgacctttttcaggtatgtcccaaaagtctgtgtgtgtctactcctggacatcgcactgatctttttcagagggatcctaaaaatgtactgataactgatttctttggaagtgtacggaaagtggaaattacaacagagactattaaattgcaacaggattcagaaatcatggaaagcagctataaggaagaccagatggatgagaaactaatggaacctctgaaatatgctgaacaacttcctgtagctcagataatacaccagaaaccgaagctgaaagactggcatcctcctgggggctttattctgggattatgggcacttattatcatggttttcttcaaaacttatggaattaagcatatgaagttcattttttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) subunit, beta type, 10 - phosphatidylinositol glycan anchor biosynthesis, class Z - tumor necrosis factor (ligand) superfamily, member 18 - matrix metallopeptidase 3 (stromelysin 1, progelatinase) |