Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TNFSF18-tumor necrosis factor (ligand) superfamily, member 18 Gene
PTXBC069319
New product
Data sheet of TNFSF18-tumor necrosis factor (ligand) superfamily, member 18 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNFSF18-tumor necrosis factor (ligand) superfamily, member 18 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069319 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNFSF18 |
| Origin species: | Human |
| Product name: | TNFSF18-tumor necrosis factor (ligand) superfamily, member 18 Gene |
| Size: | 2ug |
| Accessions: | BC069319 |
| Gene id: | 8995 |
| Gene description: | tumor necrosis factor (ligand) superfamily, member 18 |
| Synonyms: | AITRL; GITRL; TL6; TNLG2A; hGITRL; tumor necrosis factor ligand superfamily member 18; AITR ligand; GITR ligand; activation-inducible TNF-related ligand; glucocorticoid-induced TNF-related ligand; glucocorticoid-induced TNFR-related protein ligand; tumor necrosis factor (ligand) superfamily, member 18; tumor necrosis factor ligand 2A; tumor necrosis factor superfamily member 18 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgtttgagccacttggaaaatatgcctttaagccattcaagaactcaaggagctcagagatcatcctggaagctgtggctcttttgctcaatagttatgttgctatttctttgctccttcagttggctaatctttatttttctccaattagagactgctaaggagccctgtatggctaagtttggaccattaccctcaaaatggcaaatggcatcttctgaacctccttgcgtgaataaggtgtctgactggaagctggagatacttcagaatggcttatatttaatttatggccaagtggctcccaatgcaaactacaatgatgtagctccttttgaggtgcggctgtataaaaacaaagacatgatacaaactctaacaaacaaatctaaaatccaaaatgtaggagggacttatgaattgcatgttggggacaccatagacttgatattcaactctgagcatcaggttctaaaaaataatacatactggggtatcattttactagcaaatccccaattcatctcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - matrix metallopeptidase 3 (stromelysin 1, progelatinase) - DIP2 disco-interacting protein 2 homolog A (Drosophila) - serine palmitoyltransferase, long chain base subunit 1 - pseudouridylate synthase 7 homolog (S. cerevisiae)-like |