Login to display prices
Login to display prices
PIGZ-phosphatidylinositol glycan anchor biosynthesis, class Z Gene View larger

PIGZ-phosphatidylinositol glycan anchor biosynthesis, class Z Gene

PTXBC044640

New product

Data sheet of PIGZ-phosphatidylinositol glycan anchor biosynthesis, class Z Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PIGZ-phosphatidylinositol glycan anchor biosynthesis, class Z Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC044640
Ncbi symbol: PIGZ
Product name: PIGZ-phosphatidylinositol glycan anchor biosynthesis, class Z Gene
Size: 2ug
Accessions: BC044640
Gene id: 80235
Gene description: phosphatidylinositol glycan anchor biosynthesis, class Z
Synonyms: GPI-MT-IV; PIG-Z; SMP3; GPI mannosyltransferase 4; GPI mannosyltransferase IV; SMP3 mannosyltransferase; dol-P-Man dependent GPI mannosyltransferase; phosphatidylinositol glycan, class Z; phosphatidylinositol-glycan biosynthesis class Z protein; phosphatidylinositol glycan anchor biosynthesis class Z
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagatctgtggatccagcgtagcatctgtagcagctgggacatcattccaggttttgggcccggtgtgttggcaacaactggatctgaagatggcagtcagggtgctttggggtggtctcagcctgctccgagtgctgtggtgtctccttccgcagacgggctatgtgcacccagatgagttcttccagtcccctgaggtgatggcagaggacatcctgggcgttcaggccgcgcggccctgggagttttaccccagcagctcctgccgctcggtgctcttccccctgctgatctccggttccaccttctggctgctcaggctctgggaggagctggggccgtggcctggcctggtgagcggctatgcgctgctggtggggcctcgactcctcctcactgccctttcctttgctctggacggggccgtgtaccacctggccccgccgatgggggcggatcgctggaacgccctggccctgctgtctggttcctacgtcaccctggtcttctacacaaggaccttctccaacaccattgagggactcctcttcacgtggctgctggtgctggtatcctcccatgtaacgtggggccctacacgcaaggagccggcgccgggtccacggtggcgcagctggcttcttggaggcattgtggctgctggcttcttcaaccggcccacctttctggcctttgctgtggtccccctctacctctggggcactcgtggagccacaaaccctggtttgaagtctctgacccgggaggccctggtgctgctccctggggcgaccctcacagcagcggtgtttgtggccacggacagctggtatttctccagccccgctacatccaggaaccttgtcctgacacctgtcaacttcctgcactacaacctgaatccccaaaacctggcgagacatggcacgcacgcgcggctcactcacctggcagtcaacggcttcctgctcttcggggtgctgcatgcccaggccctgcaggctgcgtggcaacagctgcaagtcggcctccaggcctctgcacaaatgggcctcctgagggcactgggtgcccggagcctgctgtccagccccaggtcctatctccttctcctctacttcatgcctctggccctgctatctgcctttagccaccaggaggctcggttcctgattcccctcctggtccccctggtcctgctttgtagtccacagacgcagcctgtgccttggaagggcactgtggtcctcttcaacgccctcggtgccctcctcttcggctgcctgcatcaggggggcctggtgcctggcctggagtacctggagcaggtggtccatgcccctgtgctcccaagcacacccacccactacacactcctcttcactcacacctacatgcccccccggcacctcctacacctcccaggcctgggggcaccagtggaggtggtggacataggggggactgaggactgggccctgtgccaaaccctgaaaagcttcaccagacaaccagcctgccaagtggctggtgggccatggctctgccgcctctttgtggtaacccctggcaccaccaggcgtgccgtggagaagtgcagcttccccttcaagaatgaaacacttttatttccccatctgaccctggaggatccaccagccctgtcctccttgctgagtggggcttggagggaccacctcagtcttcacattgtggagctgggggaagaaacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: