Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMB10-proteasome (prosome, macropain) subunit, beta type, 10 Gene
PTXBC052369
New product
Data sheet of PSMB10-proteasome (prosome, macropain) subunit, beta type, 10 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMB10-proteasome (prosome, macropain) subunit, beta type, 10 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC052369 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMB10 |
| Origin species: | Human |
| Product name: | PSMB10-proteasome (prosome, macropain) subunit, beta type, 10 Gene |
| Size: | 2ug |
| Accessions: | BC052369 |
| Gene id: | 5699 |
| Gene description: | proteasome (prosome, macropain) subunit, beta type, 10 |
| Synonyms: | LMP10; MECL1; beta2i; proteasome subunit beta type-10; low molecular mass protein 10; macropain subunit MECl-1; multicatalytic endopeptidase complex subunit MECl-1; proteasome (prosome, macropain) subunit, beta type, 10; proteasome MECl-1; proteasome catalytic subunit 2i; proteasome subunit MECL1; proteasome subunit beta 7i; proteasome subunit beta-2i; proteasome subunit beta 10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgaagccagccctggagccccgagggggcttctccttcgagaactgccaaagaaatgcatcattggaacgcgtcctcccggggctcaaggtccctcacgcacgcaagaccgggaccaccatcgcgggcctggtgttccaagacggggtcattctgggcgccgatacgcgagccactaacgattcggtcgtggcggacaagagctgcgagaagatccacttcatcgcccccaaaatctactgctgtggggctggagtagccgcggacgccgagatgaccacacggatggtggcgtccaagatggagctacacgcgttatctacgggccgcgagccccgcgtggccacggtcactcgcatcctgcgccagacgctcttcaggtaccagggccacgtgggtgcatcgctgatcgtgggcggcgtagacctgactggaccgcagctctacggtgtgcatccccatggctcctacagccgtctgcccttcacagccctgggctctggtcaggacgcggccctggcggtgctagaagaccggttccagccgaacatgacgctggaggctgctcaggggctgctggtggaagccgtcaccgccgggatcttgggtgacctgggctccgggggcaatgtggacgcatgtgtgatcacaaagactggcgccaagctgctgcggacactgagctcacccacagagcccgtgaagaggtctggccgctaccactttgtgcctggaaccacagctgtcctgacccagacagtgaagccactaaccctggagctagtggaggaaactgtgcaggctatggaggtggagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphatidylinositol glycan anchor biosynthesis, class Z - tumor necrosis factor (ligand) superfamily, member 18 - matrix metallopeptidase 3 (stromelysin 1, progelatinase) - DIP2 disco-interacting protein 2 homolog A (Drosophila) |