Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC22A13-solute carrier family 22 (organic anion transporter), member 13 Gene
PTXBC035973
New product
Data sheet of SLC22A13-solute carrier family 22 (organic anion transporter), member 13 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC22A13-solute carrier family 22 (organic anion transporter), member 13 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC035973 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC22A13 |
| Origin species: | Human |
| Product name: | SLC22A13-solute carrier family 22 (organic anion transporter), member 13 Gene |
| Size: | 2ug |
| Accessions: | BC035973 |
| Gene id: | 9390 |
| Gene description: | solute carrier family 22 (organic anion transporter), member 13 |
| Synonyms: | OAT10; OCTL1; OCTL3; ORCTL-3; solute carrier family 22 member 13; organic cationic transporter-like 3; organic-cation transporter like 3; solute carrier family 22 (organic anion transporter), member 13; solute carrier family 22 (organic anion/urate transporter), member 13 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcagtttgtccaggtcctggctgaaataggtgactttggtcgcttccagatacagctattgatcctgctgtgtgttctcaacttcctgtctcccttctacttttttgcccatgtcttcatgatcctagatgagccccaccactgtgcagtggcttgggtgaagaaccacactttcaacctgagtgctgctgaacagctggtactgagcgtgcccctggacactgcaggtcacccagagccctgcctcatgttccggccaccccccgccaatgccagcctgcaggacatcctcagccaccgcttcaatgagacgcagccttgtgatatgggctgggaatatcctgagaacaggctcccatccctgaagaatgagttcaacctggtttgtgatcggaagcacctgaaggacaccacacagtcagtgttcatggctgggctccttgttggcaccctcatgtttgggcccctctgcgaccggattggccgcaaggccacaatcctggcgcagctgctcctcttcaccctcatcggcctggccacagcttttgtgcccagctttgagctctacatggccctgcgctttgctgtggctactgccgtcgctggacttagcttcagcaatgtcaccctactgacagaatgggtggggccctcatggaggacgcaggccgtggtcctggcccagtgcaacttctccctcgggcagatggtgcttgcgggactcgcctacggtttccgcaactggaggctccttcagatcaccggcactgcgcctggcttactgctcttcttctacttctgggctctgccagaatctgcacgttggctcctgacccgtgggaggatggacgaggcgatacaactgatccagaaggcggcctcggtcaataggcggaaactctccccggagctcatgaaccagctggtcccagagaagacaggcccctcagggaatgccctggatctgttcagacacccccagctccggaaggtgaccctgattatcttctgtgtctggtttgtggacagtctggggtactacggcctgagcctccaagtgggggacttcggcctggacgtctatctgacgcagctcatctttggagctgttgaggtgcctgcccgctgttccagcatcttcatgatgcagaggtttggccgcaagtggagccagttggggaccttggtcttgggtggcctgatgtgtatcatcatcatcttcatcccagcagatctgcccgtggtggtcaccatgctggctgtggtggggaagatggccacagctgctgcctttaccatctcctatgtgtactctgccgagtttttccccaccatcctccgacaggcatggggctggtgggcatcttctcacggatcgggggcatcctcacaccacttgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - guanine nucleotide binding protein (G protein), alpha z polypeptide - transient receptor potential cation channel, subfamily M, member 1 - ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G - PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) |