Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
HLA-DPB2-major histocompatibility complex, class II, DP beta 2 (pseudogene) Gene
PTXBC017967
New product
Data sheet of HLA-DPB2-major histocompatibility complex, class II, DP beta 2 (pseudogene) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HLA-DPB2-major histocompatibility complex, class II, DP beta 2 (pseudogene) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017967 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HLA-DPB2 |
| Origin species: | Human |
| Product name: | HLA-DPB2-major histocompatibility complex, class II, DP beta 2 (pseudogene) Gene |
| Size: | 2ug |
| Accessions: | BC017967 |
| Gene id: | 3116 |
| Gene description: | major histocompatibility complex, class II, DP beta 2 (pseudogene) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgatcctgcaggtttcagggggcccctggacagtggctctgacagcattactgatggtgctgctcatatctgtggtccagagcagggccactccagagaattccgtctaccaggaacggcaggaatgctatgcgttcaatgggactcagcgcgttgtggacgggctcatctacaaccgggaggaatacgtgcattttgacagcgcagtgggggagttcctagcagtgatggagctggggcggcccataggcgagtacttcaatagccagaaggactttatggaacggaagcgagccgaggtggacaaggtgtgcagacacaagtacgagctgatggagccactcatccggcagcgccgaggagacgtaaccataactgctgttagggggtgttggacgacgattctttctggctacttcctgctgaaaaggggcgtcgtgtcggggggctgcagttggggctcctcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 6 (neutral amino acid transporter), member 15 - recombination signal binding protein for immunoglobulin kappa J region - SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae) - Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide |