Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of LEPROT-leptin receptor overlapping transcript Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LEPROT-leptin receptor overlapping transcript Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC056250 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LEPROT |
| Origin species: | Human |
| Product name: | LEPROT-leptin receptor overlapping transcript Gene |
| Size: | 2ug |
| Accessions: | BC056250 |
| Gene id: | 54741 |
| Gene description: | leptin receptor overlapping transcript |
| Synonyms: | LEPR; OB-RGRP; OBRGRP; VPS55; leptin receptor gene-related protein; DnaJ (Hsp40) homolog, subfamily C, member 6; OB-R gene-related protein; endospanin-1; leptin receptor overlapping transcript protein; leptin receptor overlapping transcript |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgggcgttaaagctctcgtggcattatccttcagtggggctattggactgacttttcttatgctgggatgtgccttagaggattatggcgtttactggcccttattcgtcctgattttccacgccatctcccccatcccccatttcattgccaaaagagtcacctatgactcagatgcaaccagtagtgcctgtcgggaactggcatatttcttcactactggaattgttgtttctgcctttggatttcctgttattcttgctcgtgtggctgtgatcaaatggggagcctgcggccttgtgttggcaggcaatgcagtcattttccttacaattcaagggtttttccttatatttggaagaggagatgattttagctgggagcagtggtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - apoptosis-inducing, TAF9-like domain 1 - prostaglandin D2 synthase, hematopoietic - apolipoprotein H (beta-2-glycoprotein I) - pregnancy specific beta-1-glycoprotein 2 |