Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of APITD1-apoptosis-inducing, TAF9-like domain 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about APITD1-apoptosis-inducing, TAF9-like domain 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029430 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | APITD1 |
| Origin species: | Human |
| Product name: | APITD1-apoptosis-inducing, TAF9-like domain 1 Gene |
| Size: | 2ug |
| Accessions: | BC029430 |
| Gene id: | 378708 |
| Gene description: | apoptosis-inducing, TAF9-like domain 1 |
| Synonyms: | APITD1; CENP-S; FAAP16; MHF1; centromere protein S; FANCM associated histone fold protein 1; FANCM-interacting histone fold protein 1; Fanconi anemia-associated polypeptide of 16 kDa; apoptosis-inducing TAF9-like domain-containing protein 1; apoptosis-inducing, TAF9-like domain 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggaggaggcggagaccgaggagcagcagcgattctcttaccaacagaggctaaaggcagcagttcactatactgtgggttgtctttgcgaggaagttgcattggacaaagagatgcagttcagcaaacagaccattgcggccatttcggagctgactttccgacagtgtgaaaattttgccaaagaccttgaaatgtttgcaagacatgcgaaaagaaccacaattaacactgaagatgtgaagctcttagccaggaggagtaattcactgctaaaatacatcacagacaaaagtgaagagattgctcagattaacctagaacgaaaagcacagaagaaaaagaagtcagaggatggaagcaaaaattcaaggcagccagcagaggctggagtggtggaaagtgagaattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - prostaglandin D2 synthase, hematopoietic - apolipoprotein H (beta-2-glycoprotein I) - pregnancy specific beta-1-glycoprotein 2 - pregnancy specific beta-1-glycoprotein 6 |