Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of APOH-apolipoprotein H (beta-2-glycoprotein I) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about APOH-apolipoprotein H (beta-2-glycoprotein I) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020703 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | APOH |
| Origin species: | Human |
| Product name: | APOH-apolipoprotein H (beta-2-glycoprotein I) Gene |
| Size: | 2ug |
| Accessions: | BC020703 |
| Gene id: | 350 |
| Gene description: | apolipoprotein H (beta-2-glycoprotein I) |
| Synonyms: | B2G1; B2GP1; beta-2-glycoprotein 1; APC inhibitor; B2GPI; activated protein C-binding protein; anticardiolipin cofactor; apo-H; apolipoprotein H (beta-2-glycoprotein I); beta(2)GPI; apolipoprotein H |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatttctccagtgctcatcttgttctcgagttttctctgccatgttgctattgcaggacggacctgtcccaagccagatgatttaccattttccacagtggtcccgttaaaaacattctatgagccaggagaagagattacgtattcctgcaagccgggctatgtgtcccgaggagggatgagaaagtttatctgccctctcacaggactgtggcccatcaacactctgaaatgtacacccagagtatgtccttttgctggaatcttagaaaatggagccgtacgctatacgacttttgaatatcccaacacgatcagtttttcttgtaacactgggttttatctgaatggcgctgattctgccaagtgcactgaggaaggaaaatggagcccggagcttcctgtctgtgctcccatcatctgccctccaccatccatacctacgtttgcaacacttcgtgtttataagccatcagctggaaacaattccctctatcgggacacagcagtttttgaatgtttgccacaacatgcgatgtttggaaatgatacaattacctgcacgacacatggaaattggactaaattaccagaatgcagggaagtaaaatgcccattcccatcaagaccagacaatggatttgtgaactatcctgcaaaaccaacactttattacaaggataaagccacatttggctgccatgatggatattctctggatggcccggaagaaatagaatgtaccaaactgggaaactggtctgccatgccaagttgtaaagcatcttgtaaagtacctgtgaaaaaagccactgtggtgtaccaaggagagagagtaaagattcaggaaaaatttaagaatggaatgctacatggtgataaagtttctttcttctgcaaaaataaggaaaagaagtgtagctatacagaggatgctcagtgtatagatggcactatcgaagtccccaaatgcttcaaggaacacagttctctggctttttggaaaactgatgcatccgatgtaaagccatgctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pregnancy specific beta-1-glycoprotein 2 - pregnancy specific beta-1-glycoprotein 6 - dynein, light chain, roadblock-type 2 - pregnancy specific beta-1-glycoprotein 9 |