Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of DYNLRB2-dynein, light chain, roadblock-type 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DYNLRB2-dynein, light chain, roadblock-type 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC054892 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DYNLRB2 |
| Origin species: | Human |
| Product name: | DYNLRB2-dynein, light chain, roadblock-type 2 Gene |
| Size: | 2ug |
| Accessions: | BC054892 |
| Gene id: | 83657 |
| Gene description: | dynein, light chain, roadblock-type 2 |
| Synonyms: | DNCL2B; DNLC2B; ROBLD2; dynein light chain roadblock-type 2; bithoraxoid-like protein; dynein light chain 2B, cytoplasmic; dynein, cytoplasmic, light polypeptide 2B; roadblock domain-containing protein 2; testicular tissue protein Li 53 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagaggtggaggaaaccttaaagaggatccagagtcataaaggggttattggaactatggttgtaaatgcagaagatccacgctttgtgaccttcaagtatgcaagacagctgactgccttccagagaaaaagtggccaacaaatcacaataaaagattag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pregnancy specific beta-1-glycoprotein 9 - LSM14B, SCD6 homolog B (S. cerevisiae) - microsomal triglyceride transfer protein - angio-associated, migratory cell protein |