Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PGDS-prostaglandin D2 synthase, hematopoietic Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PGDS-prostaglandin D2 synthase, hematopoietic Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020734 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PGDS |
| Origin species: | Human |
| Product name: | PGDS-prostaglandin D2 synthase, hematopoietic Gene |
| Size: | 2ug |
| Accessions: | BC020734 |
| Gene id: | 27306 |
| Gene description: | prostaglandin D2 synthase, hematopoietic |
| Synonyms: | PGDS; GSTS; GSTS1; GSTS1-1; PGD2; hematopoietic prostaglandin D synthase; GST class-sigma; glutathione S-transferase sigma; glutathione-dependent PGD synthase; glutathione-dependent PGD synthetase; glutathione-requiring prostaglandin D synthase; hematopoietic prostaglandin D2 synthase; prostaglandin-H2 D-isomerase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccaaactacaaactcacttattttaatatgagggggagagcagaaattattcgttacatatttgcttatttggacatacagtatgaagaccacagaatagaacaagctgactggcctgaaatcaaatcaactctcccatttggaaaaatccccattttggaagttgatggacttactcttcaccagagcctagcaatagcaagatatttgaccaaaaacacagatttggctggaaacacagaaatggaacaatgtcatgttgatgctattgtggacactctggatgatttcatgtcatgttttccttgggcagagaaaaagcaagatgtgaaagagcagatgttcaatgagctgctcacgtataatgcgcctcatcttatgcaagacttggacacatatttaggggggagagaatggcttattggtaactctgtaacttgggcagacttctactgggagatttgcagtaccacacttttggtctttaagcctgacctgttagacaaccatccaaggctggtgactttacggaagaaagtccaagccattcctgccgtcgctaactggataaaacgaaggccccaaaccaaactctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - apolipoprotein H (beta-2-glycoprotein I) - pregnancy specific beta-1-glycoprotein 2 - pregnancy specific beta-1-glycoprotein 6 - dynein, light chain, roadblock-type 2 |