Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of ZC3HAV1L-zinc finger CCCH-type, antiviral 1-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZC3HAV1L-zinc finger CCCH-type, antiviral 1-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020784 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZC3HAV1L |
| Origin species: | Human |
| Product name: | ZC3HAV1L-zinc finger CCCH-type, antiviral 1-like Gene |
| Size: | 2ug |
| Accessions: | BC020784 |
| Gene id: | 92092 |
| Gene description: | zinc finger CCCH-type, antiviral 1-like |
| Synonyms: | C7orf39; zinc finger CCCH-type antiviral protein 1-like; zinc finger CCCH-type, antiviral 1-like; zinc finger CCCH-type containing, antiviral 1 like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggagcccacagtgtgctccttcctcaccaaggtgctgtgcgcccacggcggccgcatgttcctgaaggacctgcgcggccacgtggagctgtcggaggccaggctccgggacgtgctgcagcgcgccgggcccgagcgtttcctgctgcaggaggtggagacgcaggagggcctcggggacgcggaggccgaggcggcggccggcgcggtgggcggtggcggcacctccgcctggagggtggtggccgtgtccgggactataggtgcatgccaccatactcagctaatctttttaggtttttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tumor protein, translationally-controlled 1 - lectin, galactoside-binding, soluble, 14 - phosphodiesterase 4D interacting protein - WNT1 inducible signaling pathway protein 2 |