Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of LGALS14-lectin, galactoside-binding, soluble, 14 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LGALS14-lectin, galactoside-binding, soluble, 14 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022257 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LGALS14 |
| Origin species: | Human |
| Product name: | LGALS14-lectin, galactoside-binding, soluble, 14 Gene |
| Size: | 2ug |
| Accessions: | BC022257 |
| Gene id: | 56891 |
| Gene description: | lectin, galactoside-binding, soluble, 14 |
| Synonyms: | CLC2; PPL13; placental protein 13-like; Charcot-Leyden crystal protein 2; gal-14; lectin, galactoside-binding, soluble, 14; placental protein 13-like protein; galectin 14 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcatcactacccgtaccatacacactgcctgtttccttgcctgttggttcgtgcgtgataatcacagggacaccgatcctcacttttgtcaaggacccacagctggaggtgaatttctacactgggatggatgaggactcagatattgctttccaattccgactgcactttggtcatcctgcaatcatgaacagtcgtgtgtttggcatatggagatatgaggagaaatgctactatttaccctttgaagatggcaaaccatttgagctgtgcatctatgtgcgtcacaaggaatacaaggtaatggtaaatggccaacgcatttacaactttgcccatcgattcccgccagcatctgtgaagatgctgcaagtcttgagagatatctccctgaccagagtgcttatcagcgattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphodiesterase 4D interacting protein - WNT1 inducible signaling pathway protein 2 - zinc finger with KRAB and SCAN domains 1 - phenylalanyl-tRNA synthetase, beta subunit |