PTXBC022436
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC022436 |
Product type: | DNA & cDNA |
Ncbi symbol: | TPT1 |
Origin species: | Human |
Product name: | TPT1-tumor protein, translationally-controlled 1 Gene |
Size: | 2ug |
Accessions: | BC022436 |
Gene id: | 7178 |
Gene description: | tumor protein, translationally-controlled 1 |
Synonyms: | HRF; TCTP; p02; p23; translationally-controlled tumor protein; fortilin; histamine-releasing factor; tumor protein, translationally-controlled 1 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggtcagtaggacagaaggtaacattgatgactcgctcattggtggaaatgcctccgctgaaggccccgagggcgaaggtaccgaaagcacagtaatcactggtgtcgatattgtcatgaaccatcacctgcaggaaacaagtttcacaaaagaagcctacaagaagtacatcaaagattacatgaaatcaatcaaagggaaacttgaagaacagagaccagaaagagtaaaaccttttatgacaggggctgcagaacaaatcaagcacatccttgctaatttcaaaaactaccagttctttattggtgaaaacatgaatccagatggcatggttgctctattggactaccgtgaggatggtgtgaccccatatatgattttctttaaggatggtttagaaatggaaaaatgttaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - lectin, galactoside-binding, soluble, 14 - phosphodiesterase 4D interacting protein - WNT1 inducible signaling pathway protein 2 - zinc finger with KRAB and SCAN domains 1 |