Login to display prices
Login to display prices
UBA3-ubiquitin-like modifier activating enzyme 3 Gene View larger

UBA3-ubiquitin-like modifier activating enzyme 3 Gene

PTXBC022853

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBA3-ubiquitin-like modifier activating enzyme 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UBA3-ubiquitin-like modifier activating enzyme 3 Gene

Proteogenix catalog: PTXBC022853
Ncbi symbol: UBA3
Product name: UBA3-ubiquitin-like modifier activating enzyme 3 Gene
Size: 2ug
Accessions: BC022853
Gene id: 9039
Gene description: ubiquitin-like modifier activating enzyme 3
Synonyms: ubiquitin-activating enzyme E1C (homologous to yeast UBA3); ubiquitin-activating enzyme E1C (UBA3 homolog, yeast); UBA3, ubiquitin-activating enzyme E1 homolog; NAE2; UBE1C; hUBA3; NEDD8-activating enzyme E1 catalytic subunit; NEDD8-activating enzyme E1 subunit 2; NEDD8-activating enzyme E1C; Nedd8-activating enzyme hUba3; ubiquitin-activating enzyme 3; ubiquitin like modifier activating enzyme 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggatggcgaggagccggagaggaaaagaaggagaatagaggagctgctggctgagaaaatggctgttgatggtgggtgtggggacactggagactgggaaggtcgctggaaccatgtaaagaagttcctcgagcgatctggacccttcacacaccctgatttcgaaccgagcactgaatctctccagttcttgttagatacatgtaaagttctagtcattggagctggcggcttaggatgtgagctcctgaaaaatctggccttgtctggttttagacagattcatgttatagatatggacactatagatgtttccaatctaaataggcagtttttatttaggcctaaagatattggaagacctaaggctgaagttgctgcagaatttctaaatgacagagttcctaattgcaatgtagttccacatttcaacaagattcaagattttaacgacactttctatcgacaatttcatattattgtatgtggactggactctatcatcgccagaagatggataaatggcatgctgatatctcttctaaattatgaagatggtgtcttagatccaagctccattgtccctttgatagatggggggacagaaggttttaaaggaaatgcccgggtgattctgcctggaatgactgcttgtatcgaatgcacgctggaactttatccaccacaggttaattttcccatgtgcaccattgcatctatgcccaggctaccagaacactgtattgagtatgtaaggatgttgcagtggcctaaggagcagccttttggagaaggggttccattagatggagatgatcctgaacatatacaatggattttccaaaaatccctagagagagcatcacaatataatattaggggtgttacgtataggctcactcaaggggtagtaaaaagaatcattcctgcagtagcttccacaaatgcagtcattgcagctgtgtgtgccactgaggtttttaaaatagccacaagtgcatacattcccttgaataattacttggtgtttaatgatgtagatgggctgtatacatacacatttgaagcagaaagaaaggaaaactgcccagcttgtagccagcttcctcaaaatattcagttttctccatcagctaaactacaggaggttttggattatctaaccaatagtgcttctctgcaaatgaaatctccagccatcacagccaccctagagggaaaaaatagaacactttacttacagtcggtaacctctattgaagaacgaacaaggccaaatctctccaaaacattgaaagaattggggcttgttgatggacaagaactggcggttgctgatgtcaccaccccacagactgtactattcaaacttcattttacttcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: