DNAJC18-DnaJ (Hsp40) homolog, subfamily C, member 18 Gene View larger

DNAJC18-DnaJ (Hsp40) homolog, subfamily C, member 18 Gene

PTXBC030162

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DNAJC18-DnaJ (Hsp40) homolog, subfamily C, member 18 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DNAJC18-DnaJ (Hsp40) homolog, subfamily C, member 18 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030162
Product type: DNA & cDNA
Ncbi symbol: DNAJC18
Origin species: Human
Product name: DNAJC18-DnaJ (Hsp40) homolog, subfamily C, member 18 Gene
Size: 2ug
Accessions: BC030162
Gene id: 202052
Gene description: DnaJ (Hsp40) homolog, subfamily C, member 18
Synonyms: dnaJ homolog subfamily C member 18; DnaJ (Hsp40) homolog, subfamily C, member 18; DnaJ heat shock protein family (Hsp40) member C18
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgactctgggcagcggggagcgctggacggaagcttacattgacgcagttagaagaaacaaatacccagaagacacacctcctgagagtcatgacccctgtggctgctgtaactgcatgaaggcacaaaaggaaaagaagtctgagaatgagtggactcagacccggcagggtgaggggaactccacgtacagtgaggaacagctgcttggggtacaaaggatcaagaaatgcagaaattactatgaaattctgggagtttctcgagatgctagtgacgaagagcttaagaaagcttacagaaaactcgccctgaaatttcaccctgacaagaactgtgctcctggagcaacagatgctttcaaagcaataggaaatgcatttgcagtcctgagcaatcctgataagagacttcgctatgatgaatacggagatgaacaggtgactttcactgcccctcgagccagaccttataattattacagggattttgaagctgacatcactccagaagagctgttcaacgtcttctttggaggacattttcctacaggaaatattcatatgttttcaaatgtgacagatgacacttactattaccgtcgacggcaccgacatgagaggacacagactcagaaggaggaggaagaagagaaacctcagactacatattctgcatttattcagctacttccagttcttgtgattgtgattatatctgtcattactcagctgctggctactaatcccccatatagtctgttctataaatcgaccttgggctacaccatttctagagaaactcagaacctgcaggtgccttactttgtggataaaaactttgacaaggcctacagaggagcttctctgcatgacttggagaaaacaatagagaaggattacattgattatatccagactagttgttggaaggagaaacaacaaaagtcagagctgacaaatttggcaggattatacagagatgaacgattgaaacagaaagcagagtcgctgaaacttgaaaactgtgagaaactttccaaactcattggcctacgcagaggtggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - B-cell CLL/lymphoma 11A (zinc finger protein)
- copper metabolism (Murr1) domain containing 1
- HSPB (heat shock 27kDa) associated protein 1
- paired immunoglobin-like type 2 receptor alpha

Buy DNAJC18-DnaJ (Hsp40) homolog, subfamily C, member 18 Gene now

Add to cart