Login to display prices
Login to display prices
DNAJC18-DnaJ (Hsp40) homolog, subfamily C, member 18 Gene View larger

DNAJC18-DnaJ (Hsp40) homolog, subfamily C, member 18 Gene

PTXBC030162

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DNAJC18-DnaJ (Hsp40) homolog, subfamily C, member 18 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DNAJC18-DnaJ (Hsp40) homolog, subfamily C, member 18 Gene

Proteogenix catalog: PTXBC030162
Ncbi symbol: DNAJC18
Product name: DNAJC18-DnaJ (Hsp40) homolog, subfamily C, member 18 Gene
Size: 2ug
Accessions: BC030162
Gene id: 202052
Gene description: DnaJ (Hsp40) homolog, subfamily C, member 18
Synonyms: dnaJ homolog subfamily C member 18; DnaJ (Hsp40) homolog, subfamily C, member 18; DnaJ heat shock protein family (Hsp40) member C18
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgactctgggcagcggggagcgctggacggaagcttacattgacgcagttagaagaaacaaatacccagaagacacacctcctgagagtcatgacccctgtggctgctgtaactgcatgaaggcacaaaaggaaaagaagtctgagaatgagtggactcagacccggcagggtgaggggaactccacgtacagtgaggaacagctgcttggggtacaaaggatcaagaaatgcagaaattactatgaaattctgggagtttctcgagatgctagtgacgaagagcttaagaaagcttacagaaaactcgccctgaaatttcaccctgacaagaactgtgctcctggagcaacagatgctttcaaagcaataggaaatgcatttgcagtcctgagcaatcctgataagagacttcgctatgatgaatacggagatgaacaggtgactttcactgcccctcgagccagaccttataattattacagggattttgaagctgacatcactccagaagagctgttcaacgtcttctttggaggacattttcctacaggaaatattcatatgttttcaaatgtgacagatgacacttactattaccgtcgacggcaccgacatgagaggacacagactcagaaggaggaggaagaagagaaacctcagactacatattctgcatttattcagctacttccagttcttgtgattgtgattatatctgtcattactcagctgctggctactaatcccccatatagtctgttctataaatcgaccttgggctacaccatttctagagaaactcagaacctgcaggtgccttactttgtggataaaaactttgacaaggcctacagaggagcttctctgcatgacttggagaaaacaatagagaaggattacattgattatatccagactagttgttggaaggagaaacaacaaaagtcagagctgacaaatttggcaggattatacagagatgaacgattgaaacagaaagcagagtcgctgaaacttgaaaactgtgagaaactttccaaactcattggcctacgcagaggtggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: