Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of COMMD1-copper metabolism (Murr1) domain containing 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about COMMD1-copper metabolism (Murr1) domain containing 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022046 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | COMMD1 |
| Origin species: | Human |
| Product name: | COMMD1-copper metabolism (Murr1) domain containing 1 Gene |
| Size: | 2ug |
| Accessions: | BC022046 |
| Gene id: | 150684 |
| Gene description: | copper metabolism (Murr1) domain containing 1 |
| Synonyms: | C2orf5; COMM domain-containing protein 1; copper metabolism (Murr1) domain containing 1; copper metabolism gene MURR1; protein Murr1; copper metabolism domain containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcgggcgagcttgagggtggcaaacccctgagcgggctgctgaatgcgctggcccaggacactttccacgggtaccccggcatcacagaggagctgctacggagccagctatatccagaggtgccacccgaggagttccgcccctttctggcaaagatgagggggattcttaagtctattgcgtctgcagacatggatttcaaccagctggaggcattcttgactgctcaaaccaaaaagcaaggtgggatcacatctgaccaagctgctgtcatttccaaattctggaagagccacaagacaaaaatccgtgagagcctcatgaaccagagccgctggaatagcgggcttcggggcctgagctggagagttgatggcaagtctcagtcaaggcactcagctcaaatacacacacctgttgccattatagagctggaattaggcaaatatggacaggaatctgaatttctgtgtttggaatttgacgaggtcaaagtcaaccaaattctgaagacgctgtcagaggtagaagaaagtatcagcacactgatcagccagcctaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - HSPB (heat shock 27kDa) associated protein 1 - paired immunoglobin-like type 2 receptor alpha - DnaJ (Hsp40) homolog, subfamily B, member 14 - protein disulfide isomerase family A, member 3 |