Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PILRA-paired immunoglobin-like type 2 receptor alpha Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PILRA-paired immunoglobin-like type 2 receptor alpha Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017812 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PILRA |
| Origin species: | Human |
| Product name: | PILRA-paired immunoglobin-like type 2 receptor alpha Gene |
| Size: | 2ug |
| Accessions: | BC017812 |
| Gene id: | 29992 |
| Gene description: | paired immunoglobin-like type 2 receptor alpha |
| Synonyms: | FDF03; paired immunoglobulin-like type 2 receptor alpha; cell surface receptor FDF03; inhibitory receptor PILR-alpha; paired immunoglobin like type 2 receptor alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggtcggcccctgctgctgcccctactgcccctgctgctgccgccagcatttctgcagcctagtggctccacaggatctggtccaagctacctttatggggtcactcaaccaaaacacctctcagcctccatgggtggctctgtggaaatccccttctccttctattacccctgggagttagccacagctcccgacgtgagaatatcctggagacggggccacttccacgggcagtccttctacagcacaaggccgccttccattcacaaggattatgtgaaccggctctttctgaactggacagagggtcagaagagcggcttcctcaggatctccaacctgcagaagcaggaccagtctgtgtatttctgccgagttgagctggacacacggagctcagggaggcagcagtggcagtccatcgaggggaccaaactctccatcacccagggtcagcagcggactaaagccacaaccccagccagggaacccttccaaaacacagaggagccatatgagaatatcaggaatgaaggacaaaatacagatcccaagctaaatcccaagctccacctcacccagagcacctcccagccaccgtcccctcaagagcccccagaacgagaccctgtactctgtcttaaaggcctaaccaatggacagccctctcaagactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DnaJ (Hsp40) homolog, subfamily B, member 14 - protein disulfide isomerase family A, member 3 - calsequestrin 1 (fast-twitch, skeletal muscle) - protein tyrosine phosphatase, receptor type, O |