Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PPP1R14A-protein phosphatase 1, regulatory (inhibitor) subunit 14A Gene
PTXBC021089
New product
Data sheet of PPP1R14A-protein phosphatase 1, regulatory (inhibitor) subunit 14A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPP1R14A-protein phosphatase 1, regulatory (inhibitor) subunit 14A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC021089 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPP1R14A |
| Origin species: | Human |
| Product name: | PPP1R14A-protein phosphatase 1, regulatory (inhibitor) subunit 14A Gene |
| Size: | 2ug |
| Accessions: | BC021089 |
| Gene id: | 94274 |
| Gene description: | protein phosphatase 1, regulatory (inhibitor) subunit 14A |
| Synonyms: | CPI-17; CPI17; PPP1INL; protein phosphatase 1 regulatory subunit 14A; 17 kDa PKC-potentiated inhibitory protein of PP1; 17-KDa protein; PKC-potentiated inhibitory protein of PP1; protein kinase C-potentiated inhibitor protein of 17 kDa; protein phosphatase 1 regulatory inhibitor subunit 14A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagctcagcggctgggcaagcgcgtgctgagcaagctgcagtctccatcgcgggcccgcgggccagggggcagtcccggggggctgcagaagcggcacgcgcgcgtcaccgtcaagtatgaccggcgggagctgcagcggcggctggacgtggagaagtggatcgacgggcgcctggaggagctgtaccgcggcatggaggcagacatgcccgatgagatcaacattgatgaattgttggagttagagagtgaagaggagagaagccggaaaatccagggactcctgaagtcatgtgggaaacctgtcgaggacttcatccaggagctgctggcaaagcttcaaggcctccacaggcagcccggcctccgccagccaagcccctcccacgacggcagcctcagccccctccaggaccgggcccggactgctcacccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - serpin peptidase inhibitor, clade B (ovalbumin), member 5 - LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae) - general transcription factor IIE, polypeptide 2, beta 34kDa - XK, Kell blood group complex subunit-related family, member 6 |