Login to display prices
Login to display prices
GTF2E2-general transcription factor IIE, polypeptide 2, beta 34kDa Gene View larger

GTF2E2-general transcription factor IIE, polypeptide 2, beta 34kDa Gene

PTXBC030572

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GTF2E2-general transcription factor IIE, polypeptide 2, beta 34kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GTF2E2-general transcription factor IIE, polypeptide 2, beta 34kDa Gene

Proteogenix catalog: PTXBC030572
Ncbi symbol: GTF2E2
Product name: GTF2E2-general transcription factor IIE, polypeptide 2, beta 34kDa Gene
Size: 2ug
Accessions: BC030572
Gene id: 2961
Gene description: general transcription factor IIE, polypeptide 2, beta 34kDa
Synonyms: TF2E2; TFIIE-B; TTD6; transcription initiation factor IIE subunit beta; TFIIE beta subunit; TFIIE-beta; general transcription factor IIE, polypeptide 2, beta 34kDa; general transcription factor IIE subunit 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatccaagcctgttgagagaaagggagctgttcaaaaaacgagctctttctactcctgtagtagaaaaacgttcagcatcttctgagtcatcatcatcatcgtcaaagaagaagaaaacaaaggtagaacatggaggatcgtcaggctctaaacaaaattctgatcatagcaatggatcatttaacttgaaagctttgtcaggaagctctggatataagtttggtgttcttgctaagattgtgaattacatgaagacacggcatcagcgaggagatacgcatcctctaaccttagatgaaattttggatgaaacacaacatttagatattggactcaagcagaaacaatggctaatgactgaggctttagtcaacaatcccaaaattgaagtaatagatgggaagtatgctttcaagcccaagtacaacgtgagagataagaaggccctacttaggctcttagatcagcatgaccagcgaggattaggaggaattcttttagaagacatagaagaagcactgcccaattcccagaaagctgtcaaggctttgggggaccagatactatttgtaaatcgtcccgataagaagaaaatacttttcttcaatgataagagctgtcagttttctgtggatgaagaatttcagaaactgtggaggagtgtcactgtagattccatggacgaggagaaaattgaagaatatctgaagcgacagggtatttcttccatgcaggaatctggaccaaagaaagtggcccctattcagagaaggaaaaagcctgcttcacagaaaaagcgacgctttaagactcataacgaacacttggctggagtgctgaaggattactctgacattacttccagcaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: