Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
XKR6-XK, Kell blood group complex subunit-related family, member 6 Gene
PTXBC024146
New product
Data sheet of XKR6-XK, Kell blood group complex subunit-related family, member 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about XKR6-XK, Kell blood group complex subunit-related family, member 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC024146 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | XKR6 |
| Origin species: | Human |
| Product name: | XKR6-XK, Kell blood group complex subunit-related family, member 6 Gene |
| Size: | 2ug |
| Accessions: | BC024146 |
| Gene id: | 286046 |
| Gene description: | XK, Kell blood group complex subunit-related family, member 6 |
| Synonyms: | C8orf21; C8orf5; C8orf7; XRG6; XK-related protein 6; Transmembrane protein C8orf5; X Kell blood group precursor-related family, member 6; X-linked Kx blood group related 6; XK, Kell blood group complex subunit-related family, member 6; XK related 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgtatgaatatgcagacgtcaacatgctgcgcctcctggagaccttcctggagagcgcgccccaactggtgctacagctctacatcatgctccagaagaacagcgccgagaccctgccctgtgtctcctctgtgacttccctgatgtccctggcttgggtgctagcctcctatcacaagctgctgcgggactccagggacgacaagaagagcatgagctacagaggggccatcatccaggtcttctggcgcctcttcaccatctcatcccgagtgatctcttttgccctctttgcttccatcttccagctctattttgggatcttcgtggtggttcactggtgcgccatggccttctggatcatccatggcggaacagacttctgcatgtccaagtgggaggagatcctcttcaacatggtggtagggatcgtgtacattttctgctggtttaacgtcaaggaagggcggactcgatatcgaatgtttgcatattatacgatagtcttgaccgagaatgctgccttgacgttcctttggtatttttacagagacccggagaccactgactcctatgcggtgccagcactgtgttgtgtctttattagctttgtggctgggatcgcaatgatgctcttatactatggcgtgctgcatcccacaggaccacgagctaagatccttgccagctcctgttgtgccgagctgctctggggcatccctttgccccccgatgttgagcccatggcgcctgagatccctgggtaccgggggacccaggttacgcccaccagagccgtaacggaacaacaggaggatctcacggctgacacttgcttgcctgttttccaagtgagacccatggggccccctaccccgttggggcgtccttacctcccagaagggcccctcattaagattgacatgccaagaaagcgatacccagcttgggatgctcattttgtagacaggaggctgagaaggactattaacattctacaatatgtcacccccaccgcagtaggcattcgatatcgagacggaccactcctctatgagttgctacagtatgagtcttcactctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - sarcoglycan, delta (35kDa dystrophin-associated glycoprotein) - eukaryotic translation initiation factor 4E family member 2 - succinate dehydrogenase complex, subunit A, flavoprotein (Fp) - potassium inwardly-rectifying channel, subfamily J, member 5 |