Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KCNJ5-potassium inwardly-rectifying channel, subfamily J, member 5 Gene
PTXBC069482
New product
Data sheet of KCNJ5-potassium inwardly-rectifying channel, subfamily J, member 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNJ5-potassium inwardly-rectifying channel, subfamily J, member 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069482 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNJ5 |
| Origin species: | Human |
| Product name: | KCNJ5-potassium inwardly-rectifying channel, subfamily J, member 5 Gene |
| Size: | 2ug |
| Accessions: | BC069482 |
| Gene id: | 3762 |
| Gene description: | potassium inwardly-rectifying channel, subfamily J, member 5 |
| Synonyms: | CIR; GIRK4; KATP1; KIR3.4; LQT13; G protein-activated inward rectifier potassium channel 4; IRK-4; cardiac ATP-sensitive potassium channel; heart KATP channel; inward rectifier K+ channel KIR3.4; potassium channel, inwardly rectifying subfamily J, member 5; potassium inwardly-rectifying channel, subfamily J, member 5; potassium voltage-gated channel subfamily J member 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctggcgattctaggaatgccatgaaccaggacatggagattggagtcactccctgggaccccaagaagattccaaaacaggcccgcgattatgtccccattgccacagaccgtacgcgcctgctggccgagggcaagaagccacgccagcgctacatggagaagagcggcaagtgcaacgtgcaccacggcaacgtccaggagacctaccggtacctgagtgacctcttcaccaccctggtggacctcaagtggcgcttcaacttgctcgtcttcaccatggtttacactgtcacctggctgttcttcggcttcatttggtggctcattgcttatatccggggtgacctggaccatgttggcgaccaagagtggattccttgtgttgaaaacctcagtggcttcgtgtccgctttcctgttctccattgagaccgaaacaaccattgggtatggcttccgagtcatcacagagaagtgtccagaggggattatactcctcttggtccaggccatcctgggctccatcgtcaatgccttcatggtggggtgcatgtttgtcaagatcagccagcccaagaagagagcggagaccctcatgttttccaacaacgcagtcatctccatgcgggacgagaagctgtgcctcatgttccgggtgggcgacctccgcaactcccacatcgtggaggcctccatccgggccaagctcatcaagtcccggcagaccaaagagggggagttcatccccctgaaccagacagacatcaacgtgggctttgacacgggcgacgaccgcctcttcctggtgtctcctctgatcatctcccacgagatcaacgagaagagccctttctgggagatgtctcaggctcagctgcatcaggaagagtttgaagttgtggtcattctagaagggatggtggaagccacaggcatgacctgccaagcccggagctcctacatggatacagaggtgctctggggccaccgattcacaccagtcctcaccttggaaaagggcttctatgaggtggactacaacaccttccatgatacctatgagaccaacacacccagctgctgtgccaaggagctggcagaaatgaagagggaaggccggctcctccagtacctccccagccccccactgctggggggctgtgctgaggcagggctggatgcagaggctgagcagaatgaagaagatgagcccaaggggctgggtgggtccagggaggccaggggctcggtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein phosphatase 2, regulatory subunit B, delta isoform - poliovirus receptor related immunoglobulin domain containing - proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 - ankyrin repeat and sterile alpha motif domain containing 1B |