Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ANKS1B-ankyrin repeat and sterile alpha motif domain containing 1B Gene
PTXBC068451
New product
Data sheet of ANKS1B-ankyrin repeat and sterile alpha motif domain containing 1B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ANKS1B-ankyrin repeat and sterile alpha motif domain containing 1B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC068451 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ANKS1B |
| Origin species: | Human |
| Product name: | ANKS1B-ankyrin repeat and sterile alpha motif domain containing 1B Gene |
| Size: | 2ug |
| Accessions: | BC068451 |
| Gene id: | 56899 |
| Gene description: | ankyrin repeat and sterile alpha motif domain containing 1B |
| Synonyms: | AIDA; AIDA-1; ANKS2; EB-1; EB1; cajalin-2; ankyrin repeat and sterile alpha motif domain-containing protein 1B; E2a-Pbx1-associated protein; amyloid-beta precursor protein intracellular domain associated protein 1; cajalin 2; ankyrin repeat and sterile alpha motif domain containing 1B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctaatggatttgacaatgtgcagtttatgggaagcaatgttatggaagatcaggatttgttggaaattggaatccttaattctgggcacagacaaagaattctacaggcaatccagctccttccaaagatgagacccattgggcatgatggctaccatcccacctctgtagctgagtggctggattccattgaactgggcgactacaccaaagcctttctaattaatggctacacttcgatggacctgttgaaaaaaatctgggaggttgaacttattaatcagtcgtctgtctgtgaaatatggacgaatcagaacgcaggatttcctttctcagcgatccatcaggttcataatacaggagactggggagaaccttccattaccttgcgacctccgaatgaagccacagcctctaccccggtacagtactggcagcatcacccagaaaagcttatcttccagtcgtgtgattacaaagctttttatttaggttctatgctgataaaagagcttagggggacagaatcaacccaagatgcttgtgcaaaaatgcgggctaactgtcagaagtctacagagcaaatgaagaaggtccctactattattctttctgtctcatataaaggagtcaaatttattgatgcaacaaataagaacataattgctgagcatgaaattcgtaatatctcctgtgctgcccaggacccagaagacctctcaacatttgcctatatcacaaaagatttgaagtctaatcaccactactgtcatgtgtttactgcctttgatgtgaatttagcctatgaaatcatcctaaccctgggacaggcattcgaagtcgcttaccagctagcactacaagcaagaaaagggggacactcctccacacttccagaaagctttgaaaacaaaccctccaaacccatccccaagccccgcgttagcattcgcaagtccgtgatcgaccgatctgagcaaaagactctggccaatctaccgtggattgtggagccgggccaagaagccaagaggggcattaataccaagtatgaaaccacgattttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 - synovial sarcoma translocation gene on chromosome 18-like 1 - branched chain keto acid dehydrogenase E1, beta polypeptide - ankyrin repeat and sterile alpha motif domain containing 1B |