SDHA-succinate dehydrogenase complex, subunit A, flavoprotein (Fp) Gene View larger

SDHA-succinate dehydrogenase complex, subunit A, flavoprotein (Fp) Gene

PTXBC041016

New product

Data sheet of SDHA-succinate dehydrogenase complex, subunit A, flavoprotein (Fp) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SDHA-succinate dehydrogenase complex, subunit A, flavoprotein (Fp) Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC041016
Product type: DNA & cDNA
Ncbi symbol: SDHA
Origin species: Human
Product name: SDHA-succinate dehydrogenase complex, subunit A, flavoprotein (Fp) Gene
Size: 2ug
Accessions: BC041016
Gene id: 6389
Gene description: succinate dehydrogenase complex, subunit A, flavoprotein (Fp)
Synonyms: CMD1GG; PGL5; SDH1; SDH2; SDHF; succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial; flavoprotein subunit of complex II; succinate dehydrogenase [ubiquinone] flavoprotein subunit; succinate dehydrogenase complex, subunit A, flavoprotein (Fp); succinate dehydrogenase complex flavoprotein subunit A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgggggtccggggcctgtcgcggctgctgagcgctcggcgcctggcgctggccaaggcgtggccaacagtgttgcaaacaggaacccgaggttttcacttcactgttgatgggaacaagagggcatctgctaaagtttcagattccatttctgctcagtatccagtagtggatcatgaatttgatgcagtggtggtaggcgctggaggggcaggcttgcgagctgcatttggcctttctgaggcagggtttaatacagcatgtgttaccaagctgtttcctaccaggtcacacactgttgcagcgcagggaggaatcaatgctgctctggggaacatggaggaggacaactggaggtggcatttctacgacaccagcactggcgacggcacggccatgatcaccagggcaggccttccttgccaggacctagagtttgttcagttccaccccacaggcatatatggtgctggttgtctcattacggaaggatgtcgtggagagggaggcattctcattaacagtcaaggcgaaaggtttatggagcgatacgcccctgtcgcgaaggacctggcgtctagagatgtggtgtctcggtcgatgactctggagatccgagaaggaagaggctgtggccctgagaaagatcacgtctacctgcagctgcaccacctacctccagagcagctggccacgcgcctgcctggcatttcagagacagccatgatctttgctggcgtggacgtcacgaaggagccgatccctgtcctccccaccgtgcattataacatgggcggcattcccaccaactacaaggggcaggtcctgaggcacgtgaatggccaggatcagattgtgcccggcctgtacgcctgtggggaggccgcctgtgcctcggtacatggtgccaaccgcctcggggcaaactcgctcttggacctggttgtctttggtcgggcatgtgccctgagcatcgaagagtcatgcaggcctggagataaagtccctccaattaaaccaaacgctggggaagaatctgtcatgaatcttgacaaattgagatttgctgatggaagcataagaacatcggaactgcgactcagcatgcagaagtcaatgcaaaatcatgctgccgtgttccgtgtgggaagcgtgttgcaagaaggttgtgggaaaatcagcaagctctatggagacctaaagcacctgaagacgttcgaccggggaatggtctggaacacagacctggtggagaccctggagctgcagaacctgatgctgtgtgcgctgcagaccatctacggagcagaggcgcggaaggagtcacggggcgcgcatgccagggaagactacaaggtgcggattgatgagtacgattactccaagcccatccaggggcaacagaagaagccctttgaggagcactggaggaagcacaccctgtcctttgtggacgttggcactgggaaggtcactctggaatatagacccgtaatcgacaaaactttgaacgaggctgactgtgccaccgtcccgccagccattcgctcctactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - potassium inwardly-rectifying channel, subfamily J, member 5
- protein phosphatase 2, regulatory subunit B, delta isoform
- poliovirus receptor related immunoglobulin domain containing
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 12

Buy SDHA-succinate dehydrogenase complex, subunit A, flavoprotein (Fp) Gene now

Add to cart