Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SERPINB5-serpin peptidase inhibitor, clade B (ovalbumin), member 5 Gene
PTXBC020713
New product
Data sheet of SERPINB5-serpin peptidase inhibitor, clade B (ovalbumin), member 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SERPINB5-serpin peptidase inhibitor, clade B (ovalbumin), member 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020713 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SERPINB5 |
| Origin species: | Human |
| Product name: | SERPINB5-serpin peptidase inhibitor, clade B (ovalbumin), member 5 Gene |
| Size: | 2ug |
| Accessions: | BC020713 |
| Gene id: | 5268 |
| Gene description: | serpin peptidase inhibitor, clade B (ovalbumin), member 5 |
| Synonyms: | PI5; serpin B5; PI-5; peptidase inhibitor 5; protease inhibitor 5 (maspin); serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 5; serpin peptidase inhibitor, clade B (ovalbumin), member 5; serpin family B member 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatgccctgcaactagcaaattcggcttttgccgttgatctgttcaaacaactatgtgaaaaggagccactgggcaatgtcctcttctctccaatctgtctctccacctctctgtcacttgctcaagtgggtgctaaaggtgacactgcaaatgaaattggacaggttcttcattttgaaaatgtcaaagatgtaccctttggatttcaaacagtaacatcggatgtaaacaaacttagttccttttactcactgaaactaatcaagcggctctacgtagacaaatctctgaatctttctacagagttcatcagctctacgaagagaccctatgcaaaggaattggaaactgttgacttcaaagataaattggaagaaacgaaaggtcagatcaacaactcaattaaggatctcacagatggccactttgagaacattttagctgacaacagtgtgaacgaccagaccaaaatccttgtggttaatgctgcctactttgttggcaagtggatgaagaaatttcctgaatcagaaacaaaagaatgtcctttcagagtcaacaaggtatgtggggcagcatgtagcagtaaaaggagcccaattatagatgtgaaaaatgacagggacagagtggggcataaatccattccaatgaggaacctgagggcacggccggcaaagtgcctttcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae) - general transcription factor IIE, polypeptide 2, beta 34kDa - XK, Kell blood group complex subunit-related family, member 6 - sarcoglycan, delta (35kDa dystrophin-associated glycoprotein) |