Login to display prices
Login to display prices
FCHSD1-FCH and double SH3 domains 1 Gene View larger

FCHSD1-FCH and double SH3 domains 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FCHSD1-FCH and double SH3 domains 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FCHSD1-FCH and double SH3 domains 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC047016
Product type: DNA & cDNA
Ncbi symbol: FCHSD1
Origin species: Human
Product name: FCHSD1-FCH and double SH3 domains 1 Gene
Size: 2ug
Accessions: BC047016
Gene id: 89848
Gene description: FCH and double SH3 domains 1
Synonyms: NWK2; F-BAR and double SH3 domains protein 1; FCH and double SH3 domains protein 1; nervous wreck homolog 2; FCH and double SH3 domains 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacagcaggacagtgttcggtgcctggcgctgcctgctggatgccaccgtggctgggggccaaacccgactccaggcgtctgaccgataccgtgacctagcagggggtacagggcggagcgccaaggagcaggtgcttaggaagggaacagagaacctccagagggcgcaggctgaggtgctgcagtctgtccgggagctgagccgaagtcggaagctgtatgggcagcgggaacgtgtgtgggccttggcacaggagaaggcggctgatgtccaggccaggctaaaccgaagtgaccatgggatcttccactctcggaccagtctccagaaactgagcaccaagctgtccgcccagtcagcccagtactcccagcagctgcaagcagcccgcaatgagtacctgcttaacttggtggctaccaatgcccacctcgaccattactaccaggaggaactgccagctctgctcaaggccctggtcagtgagctgtcagagcacttgagggaccccctgacctccctgagccacactgagctggaagccgcagaggtcatcctggagcatgcccaccgcggggagcagacaacctcccaggtaagctgggagcaagacctgaagctgtttcttcaggagcctggtgtattttcccccaccccacctcagcagtttcagccagcagggactgatcaggtgtgtgtcctggagtggggagcagaaggcgtggctggcaagagtggcctggagaaagaggttcagcgcttgaccagccgagctgcccgtgactacaagatccagaaccatgggcatcgggtactgcaacgactggagcagaggcggcagcaggcttcagagcgggaggctccaagcatagaacagaggttacaggaagtgcgagagagcatccgccgggcacaggtgagccaggtgaagggggctgcccggctggccctgctgcagggggctggcttagatgtggagcgctggctgaagccagccatgacccaggcccaggatgaggtggagcaggagcggcggctcagtgaggctcggctgtcccagagggacctctctccaaccgctgaggatgctgagctttctgactttgaggaatgtgaggagacgggagagctctttgaggagcctgccccccaagccctggccacgagggccctcccctgccctgcacacgtggtatttcgctatcagggcgtgaggatgagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 120A
- MAK16 homolog (S. cerevisiae)
- RNA methyltransferase like 1
- muscleblind-like (Drosophila)