Login to display prices
Login to display prices
MBNL1-muscleblind-like (Drosophila) Gene View larger

MBNL1-muscleblind-like (Drosophila) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MBNL1-muscleblind-like (Drosophila) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MBNL1-muscleblind-like (Drosophila) Gene

Proteogenix catalog: PTXBC050535
Ncbi symbol: MBNL1
Product name: MBNL1-muscleblind-like (Drosophila) Gene
Size: 2ug
Accessions: BC050535
Gene id: 4154
Gene description: muscleblind-like (Drosophila)
Synonyms: EXP; MBNL; muscleblind-like protein 1; muscleblind-like; triplet-expansion RNA-binding protein; muscleblind like splicing regulator 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggccgttgctccagggagaactgcaaatatcttcatccacccccacatttaaaaacgcagttggagataaatggacgcaataacttgattcagcagaagaacatggccatgttggcccagcaaatgcaactagccaatgccatgatgcctggtgccccattacaacccgtgccaatgttttcagttgcaccaagcttagccaccaatgcatcagcagccgcctttaatccctatctgggacctgtttctccaagcctggtcccggcagagatcttgccgactgcaccaatgttggttacagggaatccgggtgtccctgtacctgcagctgctgcagctgctgcacagaaattaatgcgaacagacagacttgaggtatgtcgagagtaccaacgtggcaattgcaaccgaggagaaaatgattgtcggtttgctcatcctgctgacagcacaatgattgacaccaatgacaacacagtcactgtgtgtatggattacatcaaagggagatgctctcgggaaaagtgcaaatactttcatccccctgcacatttgcaagccaagatcaaggctgcccaataccaggtcaaccaggctgcagctgcacaggctgcagccaccgcagctgccatgactcagtcggctgtcaaatcactgaagcgacccctcgaggcaacctttgacctgggaattcctcaagctgtacttcccccattaccaaagaggcctgctcttgaaaaaaccaacggtgccaccgcagtctttaacactggtattttccaataccaacaggctctagccaacatgcagttacaacagcatacagcatttctcccaccaggctcaatattgtgcatgacacccgctacaagtgttgttcccatggtgcacggtgctacgccagccactgtgtccgcagcaacaacatctgccacaagtgttcccttcgctgcaacagccacagccaaccagatacccataatatctgccgaacatctgactagccacaagtatgttacccagatgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: