TMEM120A-transmembrane protein 120A Gene View larger

TMEM120A-transmembrane protein 120A Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM120A-transmembrane protein 120A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM120A-transmembrane protein 120A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC051850
Product type: DNA & cDNA
Ncbi symbol: TMEM120A
Origin species: Human
Product name: TMEM120A-transmembrane protein 120A Gene
Size: 2ug
Accessions: BC051850
Gene id: 83862
Gene description: transmembrane protein 120A
Synonyms: NET29; TMPIT; transmembrane protein 120A; transmembrane protein induced by tumor necrosis factor alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagcccccgcccccgggcccgctgggcgactgcctgcgggactgggaggatctacagcaggacttccagaacatccaggagacccatcggctctaccgcctgaagctggaggagctgaccaaacttcagaacaattgcaccagctccatcacgcggcagaagaagcggctccaggagctggccctcgccctgaagaaatgcaaaccctccctcccagcagaggccgagggggccgcacaggagctggagaaccagatgaaagagcgccaaggcctcttctttgacatggaggcctatttgcctaagaagaatggattgtacctgagcctggttctggggaacgtcaacgtcacgctcctgagcaagcaggctaagtttgcctacaaggacgagtatgagaagttcaagctctacctcaccatcatcctcatcctcatctccttcacttgccgcttcctgctcaactccagggtgacagatgctgccttcaacttcctgctggtctggtactactgcaccctgaccatccgggagagcatcctcatcaacaacggctcccggatcaaaggctggtgggtgttccatcactacgtgtccgccttcctgtcgggagtcatgctgacgtggcccgacggtctcatgtaccagaaattccggaaccaattcctctccttttccatgtaccagagcttcgtgcagtttctccagtactactaccagagcggctgcctctaccgcctgcgggcgctgggcgagcggcacaccatggacctcactgtggagggcttccagtcctggatgtggcggggcctcaccttcctgctgccttttcttttctttggacacttctggcagctttttaacgcgctgacgttgttcaacctggcccaggaccctcagtgcaaggagtggcaggtgcttatgtgcggctttcccttcctcctccttttcctcggcaatttcttcaccaccctgagggttgtgcaccacaagtttcacagtcagcggcacgggagcaagaaggattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MAK16 homolog (S. cerevisiae)
- RNA methyltransferase like 1
- muscleblind-like (Drosophila)
- GTPase, IMAP family member 1

Buy TMEM120A-transmembrane protein 120A Gene now

Add to cart