Login to display prices
Login to display prices
MAK16-MAK16 homolog (S. cerevisiae) Gene View larger

MAK16-MAK16 homolog (S. cerevisiae) Gene

PTXBC050528

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAK16-MAK16 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAK16-MAK16 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC050528
Product type: DNA & cDNA
Ncbi symbol: MAK16
Origin species: Human
Product name: MAK16-MAK16 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC050528
Gene id: 84549
Gene description: MAK16 homolog (S. cerevisiae)
Synonyms: MAK16 homolog; protein MAK16 homolog; MAK16L; RBM13; NNP78; RNA binding motif protein 13; RNA binding protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagtcggatgatgttatctgggatacactaggaaacaagcaattttgttccttcaaaataagaaccaagactcagagcttctgccgaaatgaatatagcctgactggactgtgtaatcggtcatcctgtcccctggcaaatagtcagtatgccactattaaagaagagaaaggacagtgctacttgtatatgaaggttatagaacgagcggcttttcctcggcgtctctgggaacgggtccggcttagtaaaaactatgagaaagcactggagcaaatagatgaaaatctgatttactggccccgtttcattcgacacaaatgtaagcagagattcaccaagatcacccaatacctaattcgaattagaaaacttacactaaagcgacagaggaaacttgttcctttgagtaagaaggtggagcgtagggagaaaagaagagaggaaaaggcattaatagctgctcagctggacaatgccattgagaaggaattactggagagactgaaacaagatacgtatggcgacatctacaacttccccattcatgccttcgacaaagccctggaacaacaggaggcagagagtgactcttcagatactgaggaaaaagatgatgatgatgatgatgaggaagatgtggggaaaagagaatttgtcgaagatggtgaggtagatgagagtgacataagtgattttgaggatatggataaactggatgccagcagtgatgaagatcaggatggtaaatcctccagtgaggaggaggaagaaaaggcccttagtgcgaaacacaaaggcaaaatgcccttgagaggaccactgcagagaaaacgagcctatgtggaaatagaatacgagcaggagacagagcccgtggccaaagccaaaaccacgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RNA methyltransferase like 1
- muscleblind-like (Drosophila)
- GTPase, IMAP family member 1
- ubiquitin specific peptidase 1