ARHGDIG-Rho GDP dissociation inhibitor (GDI) gamma Gene View larger

ARHGDIG-Rho GDP dissociation inhibitor (GDI) gamma Gene

PTXBC047699

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARHGDIG-Rho GDP dissociation inhibitor (GDI) gamma Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ARHGDIG-Rho GDP dissociation inhibitor (GDI) gamma Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC047699
Product type: DNA & cDNA
Ncbi symbol: ARHGDIG
Origin species: Human
Product name: ARHGDIG-Rho GDP dissociation inhibitor (GDI) gamma Gene
Size: 2ug
Accessions: BC047699
Gene id: 398
Gene description: Rho GDP dissociation inhibitor (GDI) gamma
Synonyms: RHOGDI-3; rho GDP-dissociation inhibitor 3; Rho GDP dissociation inhibitor (GDI) gamma; RhoGDI gamma; rho GDI 3; rho-GDI gamma; Rho GDP dissociation inhibitor gamma
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgggcctggacgcgtgcgagctgggggcgcagctgctggagctgctccggctggcgctgtgcgcccgagtcctcctggctgacaaggagggtgggccgccggcagtggacgaggtgttggatgaggctgtgcccgagtaccgggcgccggggaggaagagcctcttggagatccggcagctggacccggacgacaggagcctggccaagtacaagcgggtgctgctggggcccctgccaccggccgtggacccaagcctgcccaatgtgcaggtgaccaggctgacactcctgtcggaacaggctccggggcccgtcgtcatggatctcacaggggacctggctgttctgaaggaccaggtgtttgtcctgaaggaaggtgttgattacagagtgaagatctccttcaaggtccacagggagattgtcagcggcctcaagtgtctgcaccacacctaccgccggggcctgcgcgtggacaagaccgtctacatggtgggcagctatggcccgagcgcccaggagtatgagtttgtgactccggtggaggaagcgccgaggggtgcgctggtgcggggcccctatctggtggtgtccctcttcaccgacgatgacaggacgcaccacctgtcctgggagtggggtctctgcatctgccaggactggaaggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - katanin p60 (ATPase-containing) subunit A 1
- actin filament associated protein 1-like 1
- DnaJ (Hsp40) homolog, subfamily C, member 3
- galactosamine (N-acetyl)-6-sulfate sulfatase

Buy ARHGDIG-Rho GDP dissociation inhibitor (GDI) gamma Gene now

Add to cart