Login to display prices
Login to display prices
AFAP1L1-actin filament associated protein 1-like 1 Gene View larger

AFAP1L1-actin filament associated protein 1-like 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AFAP1L1-actin filament associated protein 1-like 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about AFAP1L1-actin filament associated protein 1-like 1 Gene

Proteogenix catalog: PTXBC040723
Ncbi symbol: AFAP1L1
Product name: AFAP1L1-actin filament associated protein 1-like 1 Gene
Size: 2ug
Accessions: BC040723
Gene id: 134265
Gene description: actin filament associated protein 1-like 1
Synonyms: actin filament-associated protein 1-like 1; AFAP1-like protein 1; actin filament associated protein 1 like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaccgaggccaggtgctggagcagctgctcccagagctcaccgggctgctcagcctcctggaccacgagtacctcagcgataccaccctggaaaagaagatggccgtggcctccatcctgcagagcctgcagccccttccagcaaaggaggtctcctacctgtatgtgaacacagcagacctccactcggggcccagcttcgtggaatccctctttgaagaatttgactgtgacctgagtgaccttcgggacatgccagaggatgatggggagcccagcaaaggagccagccctgagctagccaagagcccacgcctgagaaacgcggccgacctgcctccaccgctccccaacaagcctccccctgaggactactatgaagaggcccttcctctgggacccggcaagtcgcctgagtacatcagctcccacaatggctgcagcccctcacactcgattgtggatggctactatgaggacgcagacagcagctaccctgcaaccagggtgaacggcgagcttaagagctcctataatgactctgacgcaatgagcagctcctatgagtcctacgatgaagaggaggaggaagggaagagcccgcagccccgacaccagtggccctcagaggaggcctccatgcacctggtgagggaatgcaggatatgtgccttcctgctgcggaaaaagcgtttcgggcagtgggccaagcagctgacagtcatcagggaggaccagctcctgtgttacaaaagctccaaggatcggcagccacatctgaggttggcactggatacctgcagcatcatctacgtgcccaaggacagccggcacaagaggcacgagctgcgtttcacccagggggctaccgaggtcttggtgctggcactgcagagccgagagcaggccgaggagtggctgaaggtcatccgagaagtgagcaagccagttgggggagctgagggagtggaggtccccagatccccagtcctcctgtgcaagttggacctggacaaggtatatctgtctccactaagtcttccccaggccaggcagtggccactcaacacgggctcaaccccaggggaactaactggctggggggaaagtcaggcaactgccaaactgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: