AFAP1L1-actin filament associated protein 1-like 1 Gene View larger

AFAP1L1-actin filament associated protein 1-like 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AFAP1L1-actin filament associated protein 1-like 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about AFAP1L1-actin filament associated protein 1-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC040723
Product type: DNA & cDNA
Ncbi symbol: AFAP1L1
Origin species: Human
Product name: AFAP1L1-actin filament associated protein 1-like 1 Gene
Size: 2ug
Accessions: BC040723
Gene id: 134265
Gene description: actin filament associated protein 1-like 1
Synonyms: actin filament-associated protein 1-like 1; AFAP1-like protein 1; actin filament associated protein 1 like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaccgaggccaggtgctggagcagctgctcccagagctcaccgggctgctcagcctcctggaccacgagtacctcagcgataccaccctggaaaagaagatggccgtggcctccatcctgcagagcctgcagccccttccagcaaaggaggtctcctacctgtatgtgaacacagcagacctccactcggggcccagcttcgtggaatccctctttgaagaatttgactgtgacctgagtgaccttcgggacatgccagaggatgatggggagcccagcaaaggagccagccctgagctagccaagagcccacgcctgagaaacgcggccgacctgcctccaccgctccccaacaagcctccccctgaggactactatgaagaggcccttcctctgggacccggcaagtcgcctgagtacatcagctcccacaatggctgcagcccctcacactcgattgtggatggctactatgaggacgcagacagcagctaccctgcaaccagggtgaacggcgagcttaagagctcctataatgactctgacgcaatgagcagctcctatgagtcctacgatgaagaggaggaggaagggaagagcccgcagccccgacaccagtggccctcagaggaggcctccatgcacctggtgagggaatgcaggatatgtgccttcctgctgcggaaaaagcgtttcgggcagtgggccaagcagctgacagtcatcagggaggaccagctcctgtgttacaaaagctccaaggatcggcagccacatctgaggttggcactggatacctgcagcatcatctacgtgcccaaggacagccggcacaagaggcacgagctgcgtttcacccagggggctaccgaggtcttggtgctggcactgcagagccgagagcaggccgaggagtggctgaaggtcatccgagaagtgagcaagccagttgggggagctgagggagtggaggtccccagatccccagtcctcctgtgcaagttggacctggacaaggtatatctgtctccactaagtcttccccaggccaggcagtggccactcaacacgggctcaaccccaggggaactaactggctggggggaaagtcaggcaactgccaaactgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DnaJ (Hsp40) homolog, subfamily C, member 3
- galactosamine (N-acetyl)-6-sulfate sulfatase
- v-akt murine thymoma viral oncogene homolog 2
- cytochrome c oxidase subunit 8A (ubiquitous)

Buy AFAP1L1-actin filament associated protein 1-like 1 Gene now

Add to cart