Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of COX8A-cytochrome c oxidase subunit 8A (ubiquitous) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about COX8A-cytochrome c oxidase subunit 8A (ubiquitous) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC063025 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | COX8A |
| Origin species: | Human |
| Product name: | COX8A-cytochrome c oxidase subunit 8A (ubiquitous) Gene |
| Size: | 2ug |
| Accessions: | BC063025 |
| Gene id: | 1351 |
| Gene description: | cytochrome c oxidase subunit 8A (ubiquitous) |
| Synonyms: | COX; COX8; COX8-2; COX8L; VIII; VIII-L; cytochrome c oxidase subunit 8A, mitochondrial; cytochrome c oxidase polypeptide VIII-liver/heart; cytochrome c oxidase subunit 8-2; cytochrome c oxidase subunit 8A (ubiquitous); cytochrome c oxidase subunit VIIIA (ubiquitous); cytochrome c oxidase subunit 8A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccgtcctgacgccgctgctgctgcggggcttgacaggctcggcccggcggctcccagtgccgcgcgccaagatccattcgttgccgccggaggggaagcttgggatcatggaattggccgttgggcttacctcctgcttcgtgaccttcctcctgccagcgggctggatcctgtcacacctggagacctacaggaggccagagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cyclic AMP-regulated phosphoprotein, 21 kD - DNA (cytosine-5-)-methyltransferase 3 alpha - cold shock domain containing C2, RNA binding - leucine zipper and CTNNBIP1 domain containing |