PTXBC063443
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC063443 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LZIC |
| Origin species: | Human |
| Product name: | LZIC-leucine zipper and CTNNBIP1 domain containing Gene |
| Size: | 2ug |
| Accessions: | BC063443 |
| Gene id: | 84328 |
| Gene description: | leucine zipper and CTNNBIP1 domain containing |
| Synonyms: | protein LZIC; leucine zipper and CTNNBIP1 domain-containing protein; leucine zipper and ICAT homologous domain-containing protein; leucine zipper domain and ICAT homologous domain containing; leucine zipper and CTNNBIP1 domain containing |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcttccagaggaaagacagagacaagcaaattaaagcagaatttagaagaacagttggatagactcatgcaacaattacaagatctggaggaatgcagagaggaacttgatacagatgaatatgaagaaaccaaaaaggaaactctggagcaactaagtgaatttaatgattcactaaagaaaattatgtctggaaatatgactttggtagatgaactaagtggaatgcagctggctattcaggcagctatcagccaggcctttaaaaccccagaggtcatcagattgtttgcaaagaaacaaccaggtcagcttcggacaaggttagcagagatggatagagatctgatggtaggaaagctggaaagagacctgtacactcaacagaaagtggagatactaacagctcttaggaaacttggagagaagctgactgcagatgatgaggccttcttgtcagcaaatgcaggtgctatactcagccagtttgagaaagtctctacagaccttggctctggagacaaaattcttgctctggcaagttttgaggttgaaaaaacaaaaaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - La ribonucleoprotein domain family, member 2 - DCP2 decapping enzyme homolog (S. cerevisiae) - La ribonucleoprotein domain family, member 4 - major histocompatibility complex, class I, F |