KATNA1-katanin p60 (ATPase-containing) subunit A 1 Gene View larger

KATNA1-katanin p60 (ATPase-containing) subunit A 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KATNA1-katanin p60 (ATPase-containing) subunit A 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KATNA1-katanin p60 (ATPase-containing) subunit A 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC050428
Product type: DNA & cDNA
Ncbi symbol: KATNA1
Origin species: Human
Product name: KATNA1-katanin p60 (ATPase-containing) subunit A 1 Gene
Size: 2ug
Accessions: BC050428
Gene id: 11104
Gene description: katanin p60 (ATPase-containing) subunit A 1
Synonyms: katanin p60 ATPase-containing subunit A1; katanin p60 (ATPase containing) subunit A 1; katanin p60 subunit A1; p60 katanin; katanin catalytic subunit A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtcttcttatgattagtgagaatgtaaaattggctcgtgaatatgcattgctgggaaactatgactctgcgatggtctattatcagggagttcttgaccaaatgaacaagtatctgtactcagtcaaagatacatacctccagcagaaatggcaacaggtttggcaggaaataaatgtggaagctaaacatgttaaagatatcatgaaaacactagagagctttaaactggacagcactcccttgaaagcggcacagcatgaccttccagcttctgagggagaagtctggtccatgcctgtacctgttgaacgaagaccctcaccaggacctagaaaacgccaatcttctcagtacagtgaccctaaatcacatggtaatcgtccaagtacaactgtcagagttcaccgttcatctgcacagaatgttcacaatgacagagggaaagctgttcgttgtcgtgaaaagaaagaacagaataaaggaagagaggaaaagggagtactgatggtcggcccacctggcacggggaagacgctccttgctaaagcagtagctacagaatgcaagacaacattcttcaatgtctcttcatcaactttgacttccaaatacagaggagaatctgagaagcttgttcgtcttctgtttgaaatggctcgattttattctccagccaccatatttattgatgagatagactccatctgtagtcgccgagggacttctgaagaacatgaagcaagcagaagggtgaaagcggagctgctggttcagatggatggtgttggaggtacttctgaaaatgatgacccttccaaaatggttatggttctggcagctactaattttccctgggatatagatgaggctttaagacgacgccttgagaaacgaatctatattcctttgccgtcagggatgcgtccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - actin filament associated protein 1-like 1
- DnaJ (Hsp40) homolog, subfamily C, member 3
- galactosamine (N-acetyl)-6-sulfate sulfatase
- v-akt murine thymoma viral oncogene homolog 2

Buy KATNA1-katanin p60 (ATPase-containing) subunit A 1 Gene now

Add to cart