Login to display prices
Login to display prices
TBC1D7-TBC1 domain family, member 7 Gene View larger

TBC1D7-TBC1 domain family, member 7 Gene

PTXBC050465

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TBC1D7-TBC1 domain family, member 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TBC1D7-TBC1 domain family, member 7 Gene

Proteogenix catalog: PTXBC050465
Ncbi symbol: TBC1D7
Product name: TBC1D7-TBC1 domain family, member 7 Gene
Size: 2ug
Accessions: BC050465
Gene id: 51256
Gene description: TBC1 domain family, member 7
Synonyms: MGCPH; PIG51; TBC7; TBC1 domain family member 7; TS complex subunit 3; cell migration-inducing protein 23
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactgaggactctcagagaaactttcgttcagtatattatgagaaagtggggtttcgtggagttgaagaaaagaaatcattagaaattctcctaaaagatgaccgtctgggaatcttgcctccacaccacgagtcccatgccaaggtgatgatgtatcgtaaggagcagtacttggatgtccttcatgccctgaaagtcgttcgctttgttagtgatgccacacctcaggctgaagtctatctccgcatgtatcagctggagtctgggaagttacctcgaagtccctcttttccactggagccagatgatgaagtgtttcttgccatagctaaagccatggaggaaatggtggaagatagtgtcgactgttactggatcacccgacgctttgtgaaccaattaaataccaagtaccgggattccttgccccagttgccaaaagcgtttgaacaatacttgaatctggaagatggcagactgctgactcatctgaggatgtgttccgcggcgcccaaacttccttatgatctctggttcaagaggtgctttgcgggatgtttgcctgaatccagtttacagagggtttgggataaagttgtgagtggatcctgtaagatcctagtttttgtagctgtcgaaattttattaacctttaaaataaaagttatggcactgaacagtgcagagaagataacaaagtttctggaaaatattccccaggacagctcagacgcgatcgtgagcaaggccattgacttgtggcacaaacactgtgggaccccggtccattcaagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: