Login to display prices
Login to display prices
HS1BP3-HCLS1 binding protein 3 Gene View larger

HS1BP3-HCLS1 binding protein 3 Gene

PTXBC057389

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HS1BP3-HCLS1 binding protein 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HS1BP3-HCLS1 binding protein 3 Gene

Proteogenix catalog: PTXBC057389
Ncbi symbol: HS1BP3
Product name: HS1BP3-HCLS1 binding protein 3 Gene
Size: 2ug
Accessions: BC057389
Gene id: 64342
Gene description: HCLS1 binding protein 3
Synonyms: ETM2; HS1-BP3; HCLS1-binding protein 3; HS1-binding protein 3; HSP1BP-3; HCLS1 binding protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagtccccggcggtgctcgtcacctccaggcgacttcagaatgcccacactggcctcgacctgactgtgccccagcaccaggaggtacggggcaagatgatgtctggacacgtggagtaccagatcctggtggtgacccgtctggctgcgttcaagtcggccaagcacaggcccgaggatgtcgtccagttcttggtctccaaaaagtacagcgagattgaggagttttaccagaaactgagcagtcgttatgcagcagccagcctccccccactacccaggaaggtcctgtttgttggggagtctgacatccgggagaggagagccgtgttcaatgagatcctgcgctgtgtctccaaggatgccgagttggcaggcagcccagagctgctagagttcttaggtaccagatccccaggggctgcagggctcaccagcagagattcctctgtcctggatggcacagacagtcagacagggaatgatgaagaggctttcgacttttttgaggagcaagaccaagtggcagaagagggtccgcctgtccagagcctgaagggcgaggatgctgaggaatccttggaggaggaggaggcgctggaccctctgggcattatgcggttggtctcctgttgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: