INO80E-INO80 complex subunit E Gene View larger

INO80E-INO80 complex subunit E Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of INO80E-INO80 complex subunit E Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about INO80E-INO80 complex subunit E Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC047712
Product type: DNA & cDNA
Ncbi symbol: INO80E
Origin species: Human
Product name: INO80E-INO80 complex subunit E Gene
Size: 2ug
Accessions: BC047712
Gene id: 283899
Gene description: INO80 complex subunit E
Synonyms: AI225782; AI854876; Ccdc85; Ccdc95; INO80 complex subunit E; NO80 complex subunit E; coiled-coil domain containing 95
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacgggccggcggacggcgaagtggactacaaaaaaaaataccggaatctgaagcggaagctcaagttcctcatctacgagcacgagtgcttccaggaggagctgaggaaagcgcaaaggaaattactgaaggtgtcccgggacaagagtttcctcctagaccgacttctgcagtacgagaacgtggatgaagactcttcggactcagatgccactgcatcatcagataacagcgagacggaggggacacccaagttgtctgacacaccggcccctaagaggaagagaagccctccgctggggggcgccccctctccctccagcctctccctgcctccttcaacagggtttccccttcaggcctccggggtcccctccccatacctgagctcgctggcctcctcccgctaccccccattcccttctgactacctggccctgcagctgcccgagcccagtcccctgaggcccaagcgggagaaacggccccgcctgccccggaaactcaagatggcggtgggaccccccgactgccctgtgggagggccgctgaccttccctggccggggttctggggctggggtcgggacaaccctgacccccctcccaccccctaagatgcccccccccacgatcctgagcacggtccctcggcagatgttcagcgatgcaggtagcggggacgatgccttggatggagacgatgacctggtgatcgacatcccggagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - HCLS1 binding protein 3
- INO80 complex subunit B
- adiponectin receptor 2
- zinc finger protein 410

Buy INO80E-INO80 complex subunit E Gene now

Add to cart