Login to display prices
Login to display prices
ADIPOR2-adiponectin receptor 2 Gene View larger

ADIPOR2-adiponectin receptor 2 Gene

PTXBC051858

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ADIPOR2-adiponectin receptor 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ADIPOR2-adiponectin receptor 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC051858
Product type: DNA & cDNA
Ncbi symbol: ADIPOR2
Origin species: Human
Product name: ADIPOR2-adiponectin receptor 2 Gene
Size: 2ug
Accessions: BC051858
Gene id: 79602
Gene description: adiponectin receptor 2
Synonyms: ACDCR2; PAQR2; adiponectin receptor protein 2; progestin and adipoQ receptor family member II; adiponectin receptor 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacgagccaacagaaaaccgattggggtgcagcaggactccagagccagatataaggctcagaaaagggcaccaactggatggtacacgaagaggtgataatgacagccaccaaggagatttggagcccattttagaggcatctgttctatcttcccatcataaaaaaagctctgaggaacatgaatacagtgatgaagctcctcaggaagatgagggctttatgggcatgtcccctctcttacaagcccatcatgctatggaaaaaatggaagaatttgtttgtaaggtatgggaaggtcggtggcgagtgatccctcatgatgtactaccagactggctcaaggataatgacttcctcttgcatggacaccggcctcctatgccttctttccgggcctgttttaagagcattttcagaatacacacagaaacaggcaacatttggacacatctcttaggttgtgtattcttcctgtgcctggggatcttttatatgtttcgcccaaatatctcctttgtggcccctctgcaagagaaggtggtctttggattatttttcttaggagccattctctgcctttctttttcatggctcttccacacagtctactgccactcagagggggtctctcggctcttctctaaactggattactctggtattgctcttctgattatgggaagttttgttccttggctttattattctttctactgtaatccacaaccttgcttcatctacttgattgtcatctgtgtgctgggcattgcagccattatagtctcccagtgggacatgtttgccacccctcagtatcggggagtaagagcaggagtgtttttgggcctaggcctgagtggaatcattcctaccttgcactatgtcatctcggaggggttccttaaggccgccaccatagggcagataggctggttgatgctgatggccagcctctacatcacaggagctgccctgtatgctgcccggatccccgaacgctttttccctggcaaatgtgacatctggtttcactctcatcagctgtttcatatctttgtggttgctggagcttttgttcacttccatggtgtctcaaacctccaggagtttcgtttcatgatcggcgggggctgcagtgaagaggatgcactgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 410
- cell adhesion molecule 1
- zinc finger protein 169
- mahogunin, ring finger 1